| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAGUGGGCAGCCCGAUUUUCUGCUGAGUAGGCGCUGUGAUUUCAGAAU… | 412 nt | 0.5971 |
Histone s are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histone s (H2A, H2B, H3, and H4 ). The chromatin fiber is further compacted through the interaction of a linker histone , H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]
A study in zebrafish and mouse demonstrated that the H4C16 transcript, a core histone, increased in abundance at 4 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267].