Basic Information

Symbol
H4C16
RNA class
mRNA
Alias
H4 Histone 16 HIST4H4 H4-16 Histone Cluster 4 H4 Histone 4, H4 Histone H4 MGC24116 Histone Cluster 4, H4 HIST1H4A HIST1H4B HIST1H4C HIST1H4D HIST1H4E HIST1H4F HIST1H4H HIST1H4I HIST1H4J HIST1H4K HIST1H4L HIST2H4A HIST2H4B HIST2H4 H4C11 H4C12 H4C13 H4C14 H4C15 H4/P H4C1 H4C2 H4C3 H4C4 H4C5 H4C6 H4C8 H4C9 H4/A H4FA H4/I H4FI H4/G H4FG H4/B H4FB H4/J H4FJ H4/C H4FC H4/H H4FH H4/M H4FM H4/E H4FE H4/D H4FD H4/K H4FK H4/N H4F2 H4FN H4/O H4FO
Location (GRCh38)
Forensic tag(s)
Postmortem interval inference

MANE select

Transcript ID
NM_175054.2
Sequence length
412.0 nt
GC content
0.5971

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-165.10 kcal/mol
Thermodynamic ensemble
Free energy: -171.63 kcal/mol
Frequency: 0.0000
Diversity: 91.12
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((((..(((((((.((((((..(((....)))..)....))))).))).))))..((.....((((..((((((((.....(((((((((...)))))((((((((((((((((((((.........(((........)))((((...)))))))))))..(((((....))))).))))).))))))))(((......))).....((((((((.(......).))))))))....((((.((((((.............)))))).))))......((..(((((((..(((((((((.(.(((((..((.(((......))).)).)))))))))))))))..)))))))..))..))))..)))))))))))).....))....((((((....))))))))))
Thermodynamic Ensemble Prediction
....{(((..(((((({.(((((..{({{,,{,,||,,..,..)))}}.|)).))}}{{({.....((((..{(((((((.,...((({(((((...))))){|((((((((((((((((((.........(((........)))((((...)))))))))))..(((((....))))).))))).})))))||(((.{{...)).)))}}((((((((.(......).))))))))....((((.((((((....,....}...)))))).))))...,{{,{..(((((((..(((((((((.(.(((((..((.(((......))).)).)))))))))))))))..)))))))..))},)))),.))))))))))))..,,,},....((((((....))))))))),

Transcripts

ID Sequence Length GC content
ACAGUGGGCAGCCCGAUUUUCUGCUGAGUAGGCGCUGUGAUUUCAGAAU… 412 nt 0.5971
Summary

Histone s are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histone s (H2A, H2B, H3, and H4 ). The chromatin fiber is further compacted through the interaction of a linker histone , H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H4 family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. [provided by RefSeq, Aug 2015]

Forensic Context

A study in zebrafish and mouse demonstrated that the H4C16 transcript, a core histone, increased in abundance at 4 hours postmortem in zebrafish [Pozhitkov et al. DOI:10.1098/rsob.160267].