| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUCUGGGCAUUUGGAGGUGAAGGGGUCACAGCUCUGGCAAAGAUGGGGU… | 1218 nt | 0.4828 | |
| CUGUACAGGGCAGGUUGUGCAGCUGGAGGCAGAGCAGUCCUCUCUGGGG… | 869 nt | 0.4707 |
This gene encodes a protein which, with 5-lipoxygenase, is required for leukotriene synthesis. Leukotrienes are arachidonic acid metabolites which have been implicated in various types of inflammatory responses, including asthma, arthritis and psoriasis. This protein localizes to the plasma membrane. Inhibitors of its function impede translocation of 5-lipoxygenase from the cytoplasm to the cell membrane and inhibit 5-lipoxygenase activation. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
A study in humans demonstrated that the ALOX5AP mRNA marker exhibits a blood-specific expression pattern and is stable and detectable in 13–16-year-old blood stains from large (~0.75 cm²) stains but not from small (~0.05 cm²) stains [Zubakov et al. DOI:10.1007/s00414-008-0249-z]. In a separate investigation of human circulating leukocytes following major blunt trauma, the ALOX5AP was identified among the top ten up-regulated genes [Brandfellner et al. DOI:10.1097/SHK.0b013e31829de02f]. A study in humans using peripheral blood samples from heat stroke patients identified the ALOX5AP as a core ferroptosis-related diagnostic biomarker [Yin et al. DOI:10.1186/s12920-025-02188-3].