Basic Information

Symbol
HADHA
RNA class
mRNA
Alias
Hydroxyacyl-CoA Dehydrogenase Trifunctional Multienzyme Complex Subunit Alpha LCHAD LCEH MTPA GBP Hydroxyacyl-Coenzyme A Dehydrogenase/3-Ketoacyl-Coenzyme A Thiolase/Enoyl-Coenzyme A Hydratase (Trifunctional Protein), Alpha Subunit Hydroxyacyl-CoA Dehydrogenase/3-Ketoacyl-CoA Thiolase/Enoyl-CoA Hydratase (Trifunctional Protein), Alpha Subunit Mitochondrial Trifunctional Protein, Alpha Subunit Trifunctional Enzyme Subunit Alpha, Mitochondrial Long-Chain-3-Hydroxyacyl-CoA Dehydrogenase Monolysocardiolipin Acyltransferase Long-Chain 2-Enoyl-CoA Hydratase 78 KDa Gastrin-Binding Protein Gastrin-Binding Protein MLCL AT HADH Mitochondrial Long-Chain L-3-Hydroxyacyl-Coenzyme A (CoA) Dehydrogenase, Alpha Subunit Mitochondrial Long-Chain 2-Enoyl-Coenzyme A (CoA) Hydratase, Alpha Subunit 3-Ketoacyl-Coenzyme A (CoA) Thiolase, Alpha Subunit Mitochondrial Trifunctional Enzyme, Alpha Subunit 3-Oxoacyl-CoA Thiolase EC 2.3.1.- TP-ALPHA TP-Alpha ECHA
Location (GRCh38)
2:26190635-26245044
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Drug abuse diagnoses
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000182.5
Sequence length
2943.0 nt
GC content
0.4907

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-973.40 kcal/mol
Thermodynamic ensemble
Free energy: -1029.83 kcal/mol
Frequency: 0.0000
Diversity: 583.45
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.((....((((.......))))....)).))).)))).((((((...((((.......)))).(((((((.(((((((.((((((..(((((.(((.......))).........(((((((((((.(((((((.........(((((.....))))))).))))).))).((((((((.....(((((.........)))))...(((.....((((.(((..(((....((((((((.(((...))).)).))))))...)))..))))))).....))).((((((((...(((.........)))...))).))))).((((((((((((((((....))))))).)))))))))(((..((((((........((((((((..............).))))))).....))))))..)))(((((......)))))))))))))....))))))))..)))))))))))))))).(((((...(((.((......)))))..)))))...)).))))))).(((((((((((.((((............))))))))..((((.(((((.((((((((.....(((((......))))))))))))).)))))))))....))))))).((((..((((((((.(((((((((((....(((..((((...(((((((...(((((((((((((((((....(((.......))))))).)).........(((.....)))......(((((((((..(((((((((((......))..........((((((....)))))).......))))))))).))))).))))...((((.((((..........))))))))((((((((((((...(((((((.......(((....)))......((((((...((((...((((((.........(.((((((....((.(((...(((.(((..(((((((((((((((((.......((((((..(((.(((((((.(((.((...((((((....((((((((.((((.......))))((((((((....(((..(((((.......(((((.(((.((((..((((((((((.(((.(((.((((((((..((.(((((.(((....((((((((((..((((....))))...))))..(((......)))...)))))).))))))..)).))..)))))))).))).....((((((((....)))))).))..........)))..))).))))))).))))...))).)))))))))).)))))))))))(.(((((((((((((((.((((((...))))))....)))))))).))))))).)..)))).))))..((((.(((((...))))).))))........(((((((((...))))))))).))))))...))...)))...))))))).)))(((((....)))))..(((.......)))))))))))))))))))))).)))).))))))))).))............((((((((((.((.((........)).)).)))))...((((((..((((((....((.((((((((..((..((.((((((((((...(((((((((.(((.....(((((((((.........(((((...)))))...((((........))))((..((((((.....))))..))..)).)))))))))..))).)))))))))....)))))))))).))..))..)))).)))).))..))))))))))))....)))))....(((..(((((((...(((((....((((((((((.(((((((...(((....)))((((..((((((....((((.((((((....((((((((((.....))))))))))...((((((((((.......)))))))))).(..(((((....)))))..).)))))).))))))))))..)))))))))))))))...((((((.......)))))))))))).))))))))))))..))).((((((((.(...(((((((......))))).))...).)))))))))))))).)..)))))).(((((.((((((((((....)))..))))..)))...)))))))))))))))))))))))))))))))))).((((..(((........)))..(((((((.......)).)))))...((((.............))))))))((((.((((.......)))).))))...........)))))))))))((((((((.....)))).))))((((((.(((..(((((.((.((((((.(((.....(((((........(((((........))))).......))))).....)))))))))))))))))))...)))))).........)))))))...)))).)))...(((.((.(((((((((((.......)).)))))))))))...))).(((.((((((((((((((((......(((....))).....(((((.....(((....)))...)))))((((((.((.(((((((((....(((((...))))).((((((.((..((.((((((((((........((((((........((((((.((.....))..(((....))).....))))))......(((((((((..((((....((........))..))))))))))))).....))))))))))))))))))...)).)))))).))))))))).)).).)))))..)))))).)..))))))))).))).......))))))))))).))))))))..))))......(((....)))....((((.............))))..)))))).
Thermodynamic Ensemble Prediction
..(((((((.{(....((((.......))))....)}.))}}|))}.((((((...{(((.......)))}.{((((((.{((((((.((((((..((((,,(((.......|||,,.......,((((((({((((((((.({{...{{,,(((((.....))))).}))...|{({{{.,((((.((.,..,,.,,.{((..((({.((((...(({{...,.((({{...,(({{(.,,,,,,,}}|||}}}).,.))}),,.)))}.,.))))..)))},,......,,}},))))}})}}}...}}}.}})))}.})},.,,,,,.{(((((((((((((((....)))))))},))))))))|||,,|((({{...,..,.((((((((..............}.})))))).,...)))))}..|}|{{{{{......}))))))),|||....,))}},,,)}}))))))))))))))))}(((((.{{(({.((......)))))}.)))))....}.))))))}.(((((((((((.((((.,.,,....,),))))))),..((({{(((((.((((((((.....(((((......))))))))))))).)))))))))...}))))))).((((..((((((((.(((((((((((....{({..((((...(((((((...((((((((((({(((((....|{{.......}}}}}}}.))...,,....{{{.....}|}......{({((((,,..{{||||{{,,,..,,..{{....,,..,.((((((....)))))),..,{..|||||||},.}}|||.}}||{{.((((.((((..........))))))))(((((((((((,..,((((((,.......(((....))}.....,((((((,..{(({...((((((.........,.{((((({,...{{{.....,,,,{{((,(((((((((((((((((.......((((((..,{{.(((((((.{({..{,..{{{{{{.,,.,.,,((({.,(((.{{{{,.||,,((((((((....(((..(((((.......(((((.(((.{{((..((((((((((.(((.(((.((((((((..((.((,(,,(((.,..((((((((((..((((....))))...))))..{((......)))...)))))).}))))),.)).))..)))))))).))).....{(((((({....}))))).}}..........})}..))).))))))).)))}...))).)))))))))).)))))))))))})|{(((((((((((((.((((({...})))))....)))))))).)))))||(((({({{{{....}))))))))}|}}}))|))|,}||....,{{.(((((((((...))))))))).)))}}},,.,}..,)),...))))))).}},(((((....)))))..(((.......)))))))))))))))))))))).)))).))},{{{({,{{((.{,,....,,}}}}},}}}},}}}}}}},..,,,...{(((((...,..(((((((({{{((((({...))))}||,..,,..((.((((((((((...(((((((((.((,.{{{.(((((((((.........(((((...})))).,.|{{{.|....|||}}|({..((({,,..,..))),.})},.,,.))))))))).})))})))))))))....)))))))))).)){.|,..}))}))))))))..)))))))||||{({,{{{......,|||..(((((((...(((((....((((((((((,(((((((...(((....)))((({,{((((((....((((.((((((.,,.((((((((((.....))))))))))..}|(((((((((.......))))))))),.(..(((((....)))))..).)))))).))))))))),,}))))))))))))))),..((((((.......)))))))))))).))))))))))))..}}}.((((((((.(...(((((((......))))).))...).)))))))).)))))))..)))))),(((((.(((((((({(....)))..)))),,)))...)))))))))))))))))))))))))))))))))).,{||},(((........)))..(((((((.......)),})))).,..|||......,}},,}}}})},)).((((.((((.......)))).)))).,.........)))))))))))((((((((.....)))).))))((((((.(((..(({(((((.((((((.(((...,.(((((........(((((........))))).......)))))..,..)))))))))))))))))))...)))))).........)))))))...)))).}}}.,,{((.((.(((((((((((.......)))}}))))))))),..))).(((.((((((((((((((({......{{(....|||.{{{{{((((.....,,,}}}})))}..)))||((((((.((.(((((((((....(((((...})))).((((((.((..{{.((((((((((........((((({........,,,{{,.....,},}}..(((....))),....}))}},......((((((((,.,((((....((........))..))))))))))))).....})))))))))))))))}}...)).)))))).))))))))).)).).)))))..}))))).,..))))))))).))).......))))))))))).))))))))..)))),,...,|{{,,.,|}}....((((.............))))..)))))).

Transcripts

ID Sequence Length GC content
NM_000182.5 NCBI
AGAGGCGCUCUCCACUGCUGUCCUCUUCAGCUCAAGAUGGUGGCCUGCC… 2943 nt 0.4907
Summary

This gene encodes the alpha subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the alpha subunit catalyzing the 3-hydroxyacyl-CoA dehydrogenase and enoyl-CoA hydratase activities. Mutations in this gene result in trifunctional protein deficiency or LCHAD deficiency. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats identified the HADHA as a hub fatty acid metabolism-related gene that is upregulated in erectile dysfunction (ED) samples and demonstrated high predictive efficacy for ED occurrence with an area under the curve value >0.8 [He et al. DOI:10.1093/sexmed/qfae011]. In human subcutaneous adipose tissue from BMI-discordant monozygotic twins, the HADHA was identified as a shared gene involved in the fatty acid β-oxidation and ketogenesis/ketolysis pathways [Muniandy et al. DOI:10.1038/ijo.2017.95]. A study in rats demonstrated that the HADHA (Hadhb) was identified as a potential regulator of methamphetamine reward and addiction through transcriptome profiling of whisker follicles, showing down-down regulated expression (0.69 at MASA, 0.48 at WD) and a betweenness centrality score of 0.0147, and it was previously reported as an addiction-related gene [Song et al. DOI:10.1038/s41598-018-29772-1].