| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACCAGAGCAAGCUCAAGACCCAGCAGUGGGACAGCCAGACAGACGGCAC… | 406 nt | 0.5739 |
The product encoded by this gene is involved in the maintenance of iron homeostasis, and it is necessary for the regulation of iron storage in macrophages, and for intestinal iron absorption. The preproprotein is post-translationally cleaved into mature peptides of 20, 22 and 25 amino acids, and these active peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta-sheet structures. These peptides exhibit antimicrobial activity against bacteria and fungi. Mutations in this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure. [provided by RefSeq, Oct 2014]
A study in mice and human hepatoma cells demonstrated that ethanol metabolism-mediated oxidative stress down-regulates hepcidin transcription via suppression of C/EBPα DNA binding activity, leading to increased duodenal expression of divalent metal transporter 1 and ferroportin [Harrison-Findik et al. DOI:10.1074/Jbc.M602098200].