Basic Information

Symbol
HAMP
RNA class
mRNA
Alias
Hepcidin Antimicrobial Peptide LEAP1 HEPC LEAP-1 HFE2B Liver-Expressed Antimicrobial Peptide 1 Putative Liver Tumor Regressor Hepcidin PLTR Hepcidin Preproprotein
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_021175.4
Sequence length
406.0 nt
GC content
0.5739

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-135.00 kcal/mol
Thermodynamic ensemble
Free energy: -142.15 kcal/mol
Frequency: 0.0000
Diversity: 87.64
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((.(((((((((((......((((.((((..(((((.((((.((.(((((..(((....(((((.((((...((((((((((...(((.((((..(((.....((((....((((((((((..((((.........))))......)))))))))).....))))...)))..))))..)))(((..(((((.........))))).)))..))))))))))...)))).......)))))....)))))))))))))))))))........(((.(.((((((.(..(((....((((.......))))..)))..)))))))..).)))..............)))).)))).......))))))).........)))).))))).............
Thermodynamic Ensemble Prediction
...(((((.(((((((((((.,,,..((((.((((,.(((((.{(((.((,(((({..({{....{{((,.((((...((((((((((.{.((({......{((,,,..((((....((((((((((,.((((.........)))).,....)))))))))).....))))...)})|{(((((..((((,,......,))))..)))))))})),).))))))))))...)))).......}))))}...,}}))))))))))))))))........,{(.(.((((((.(..(((.(..((((.......)))).,)))..})))))),.,.}},..........,,,.)))),}}}}.......))))))),........}))).)))))...,.........

Transcripts

ID Sequence Length GC content
ACCAGAGCAAGCUCAAGACCCAGCAGUGGGACAGCCAGACAGACGGCAC… 406 nt 0.5739
Summary

The product encoded by this gene is involved in the maintenance of iron homeostasis, and it is necessary for the regulation of iron storage in macrophages, and for intestinal iron absorption. The preproprotein is post-translationally cleaved into mature peptides of 20, 22 and 25 amino acids, and these active peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta-sheet structures. These peptides exhibit antimicrobial activity against bacteria and fungi. Mutations in this gene cause hemochromatosis type 2B, also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure. [provided by RefSeq, Oct 2014]

Forensic Context

A study in mice and human hepatoma cells demonstrated that ethanol metabolism-mediated oxidative stress down-regulates hepcidin transcription via suppression of C/EBPα DNA binding activity, leading to increased duodenal expression of divalent metal transporter 1 and ferroportin [Harrison-Findik et al. DOI:10.1074/Jbc.M602098200].