Basic Information

Symbol
HAND2
RNA class
mRNA
Alias
Heart And Neural Crest Derivatives Expressed 2 BHLHa26 Thing2 DHand Hed Deciduum, Heart, Autonomic Nervous System And Neural Crest Derivatives-Expressed Protein 2 Heart- And Neural Crest Derivatives-Expressed Protein 2 Class A Basic Helix-Loop-Helix Protein 26 DHAND Basic Helix-Loop-Helix Transcription Factor HAND2 BHLHA26 DHAND2
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_021973.3
Sequence length
2780.0 nt
GC content
0.5849

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1113.70 kcal/mol
Thermodynamic ensemble
Free energy: -1162.01 kcal/mol
Frequency: 0.0000
Diversity: 826.48
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.((...((((.....((.((......))))...))))(((((((((.((((((((.((....((.((((((((.((((((.......(((((..(((((((((((((((((.((.(((...((((((((((.(.((((((.(((((.....))))).(((((((((.((......)).)))))))))......)))).)).).)))))).((((.....((((((((...((((((((...((((......)))).))))).)))....)).....................................................((((....(((.....)))....)))).))))))..))))))))......).)).))...))))))..))))))).))).)..))))).((((((((..((.((((((((((..((((....(((((..((((.......))))..)))))..))))..)))))...))))).)).((((((((((.((((((.((((((.((....((......)).)).)))))).))((((.(((((((......)).))))).((((((.((((.((....)).))))..)))))))))))))).)))))))))).))..))))))..)))).)).)))))))).))...))..))))....(((.(((((.((.((.(((((.(((((...))).)))))))(((.((((...)))).))).((((((.(((((....(((((((((((((((...((((......((((((((.(((((.(((((((........))))))).))))).)))).))))((((((((..((((((.........))).((((....((((((((((((((((((((.(((.(((.((((.((((.((((.(((((((((.((((.......))))....(((((......))))).(((.((((....))))..)))....))))..))).)).)))))))).)))))))))).))).))))).)).....((((((((.((((........)))))))))))))))).)))))).)))).....)))..))))).))).))))..)))))))))).....))))).....)))))))).))))).)))))))))).(((((.....)))))(((((((((((((((..(((((((........)))))))))))))))))..)))))((((((((.((((..((((((((((((.(((((...((((((((....((((((((..(((((((((((.((((.........)))).))).(((((((.(((...((((.((.(((((.(((((((.((((....((...((((((......(((.((....)))))))).)))..))..)))).))))((((((((((((((.((.((.......(((((..(((((...(((((((.((.((.(((.(((...(((....)))...)))...(((.(..((((((.........(((..(.(((((((.((((....)))).))))))).)..))).((....)).....(((((.(((((.((.((((.((.((((((.(((((.(((((.((....)).))...))).......((((..(......)..)))).)))))))))))(((((....((((((...(((((....)))))......))))))..)))))..((((...............))))...)).)))))).))))).)))))....((((.(((((..(((.....)))....))))).)))).(((((..(((....))).)))))....(((((......(((..(((((...))))).))).......))))).((((.(((....)))))))))))))..).)))...))).))...)).))))...............(((((((((((((((.(((((((...(((((.......((((..(((.........))).))))....)))))...))))))))))).........((((.(((((......))))))))).))).)))))))).))).)))))...)))))..)).))))))))))..))))))(((((.(((((.((((..((((((((.(((((..........((((.((((((....)))))).((....))((((........))))..(((((((.(((......((((.(((((..........((((((((......((((((...))))))......)))))))).....))))).))))..(((((((((...(((.((((.(...........).)))).))).....)))))))))))).)))))))))))....((((...))))(((((.....)))))))))))))))))).....)))).)))))...))))).........)))...))))).)).))))..))).)))))))........((((((.....(((((((.(........))))))))..))))))..((((((((.....))))))))))))))))....))))))))...)))))))).((((..((((......))))))))....)))))..)))))...))))))))))).).)))))))...)))).))..)))))))...(((((((.((((((.(((...))).)).)))))))))))((((.....))))..)).))))............
Thermodynamic Ensemble Prediction
,{{{.{,..,((((..,..((.(({....}))))..|||||(((((((((.(((,,,,.(((((((((({{((((.(((((((((.{.....(((((((...,,,{.(((((..{.(((((.((((({{{,...,)).))))...)))))....))))),.(((((((((.((......)).))))))))),{,.{((((((((((({{|{|(((((.({......}).))))}((((((((...((((......)))).))))).)))..........,,..{{.......................,,,,.,..,,...{{,((,(({({,,..(((,...,}}}((((.(((((|,{((,.||.((((((..,(({.((({{{,.{{(,(((.{,.{{((.,,,.)},|||{}|||||{||||||||(((,..|||||.(((({((({((,{(((({((((.{.{(((({(((({.(,(((((,,.,{|,}||,|||}||.((((((((((,((((((.{{{{||.|.,,||{{|.....},.,)))))},},}|{|||,||,,,,,....{{.{(.((((......)))))).)),}}}))}))))}.,))))})})))})).}))))))))).....))}))),.})}),)})})))))||{,},.))|.(((((((..((((..{{......))))))))))))).}))}}}}})||,{((({(((,,{{|}||{{|}{{{{,,|||{(((((((((.((((.(((((((((((((((.((((((........))))))...))}}}))))))).))))(((,.((({.(((((({,(({(((({,(,((({..((((...(((.(((((((((((((..(((,{((((((((.(((.(((.((((.((((.((((.(((((((((.{(((.......||||{{{.(((((......))))),||,,((((....))))..)})}}.}))}).}))).)).)))))))).)))))))))).))).))))).||(((((((((((((.((((........)))))))))))),|||.{{((,....)))},,.{{{{.....))))....{{.{{|,,{((|...}))),,))}.}}.}}}))))))))))..)))))))).,,.(((((.....)))))(((((((((((((({.{(,(((((.......})))),))))))))))))..))))){{{((.((((...((....)).)))).))....)))...({.......)}))))}.))).....)))),.)}}).))))).,}.},))))))..,.))}..}})}}}..........)))).))))))))),.,,))}...,.)))).))))}})}.|)}}},)))),.{{.,,.||,...||||,{((|{{,{{{,{{({..((({({{((.{..((({{((((.({....(((((.{.((,.,..{(,(((,..,,...,{{{{...,|{....,,..|.}}.....},,},...(({..({(((((((.((((....)))).))))))),)}.)))|||}},.((..,({((,((.(,.((((((((.((((((((((((((((((((.(({((....)).((((((((({....((,,{((((((...((.....)}..)))).,..}}),.}),.)))))))))).....})).)))))))}.,))))..)))))))).)))).))))..))})))),...)).,}}))))),).)))))((({((....{(((.(((((..{((.....,))....))))).)))).(((((..(((....))).)))))))..}))).}).))))))))..}.))))))))}),}.))}}.)})})),))),|||{|,....,})))))..}})).))))))...}}.)))..))))).)))).....,,...))))|.)).}|||}}}}}||(((((,,.{{{{{||||||,({{{..((({,....,},))).)))),,,,,}}}}.,.}}}}}},,,,}.........((((.(((((......))))))))),)).})}))))).)))))))..))))))))))....,..{{{{.|{,.{{{{..(((((.(((((.((((,.((((((((.(((((..........{{{,.,{{,,,...{|||||{.{{....,,,||,......}})))),{(((((((.((({,,,,......|||,,.....{{{{{{,,.((......}},,}}}})}|{{.{(((((({{|{........}))))))))).}},.,{(((((((...(((.((((.(...........).)))).))).....)))))))))))).)))))))),,,....((({...)))}(((((.....)))))))))))))))))).....)))).)))))...)))))..}}}}.}}.))},.),)))))))}.,).))))))))).)))))}....((((((.....(((((((,(.....,,.})))))))..)))))).{{(((((((.....))))))))),.,,,.{{(((((((((|,.,{{|.,,,}}})))))}}))}.}}..{{(((((((.,,(((((.((((.,.........)))).)))))})))))))))))).))..}))))))...(((((((.((((((.(((...))).)).))))))))))){{{{.....}}}}..}),))),.,,.,,,..,..

Transcripts

ID Sequence Length GC content
AGCUGUACAUGGAGAUCUUGCUGGGAAAAUCCGCUUGCUCCCCUCACGU… 2780 nt 0.5849
Summary

The protein encoded by this gene belongs to the basic helix-loop-helix family of transcription factors. This gene product is one of two closely related family members, the HAND proteins, which are asymmetrically expressed in the developing ventricular chambers and play an essential role in cardiac morphogenesis. Working in a complementary fashion, they function in the formation of the right ventricle and aortic arch arteries, implicating them as mediators of congenital heart disease. In addition, this transcription factor plays an important role in limb and branchial arch development. [provided by RefSeq, Jul 2008]

Forensic Context

A review of single-cell RNA sequencing in the heart, covering studies in mouse and human models, notes that the transcription factor Hand2 is identified as a specifier of outflow tract cells but not right ventricular cells during cardiovascular development [Yamada & Nomura DOI:10.3390/ijms21218345].