| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACGAACUCCAUCUGGGAUAGCAAUAACCUGUGAAAAUGCUCCCCCGGC… | 1757 nt | 0.4400 |
This gene is one of three related genes that have 2-hydroxyacid oxidase activity yet differ in encoded protein amino acid sequence, tissue expression and substrate preference. Subcellular location of the encoded protein is the peroxisome. Specifically, this gene is expressed primarily in liver and pancreas and the encoded protein is most active on glycolate, a two-carbon substrate. The protein is also active on 2-hydroxy fatty acids. The transcript detected at high levels in pancreas may represent an alternatively spliced form or the use of a multiple near-consensus upstream polyadenylation site. [provided by RefSeq, Jul 2008]
A study in Apoe-/- mice demonstrated that cigarette smoke exposure dysregulated peroxisomal lipid metabolism, with the HAO1 being downregulated in the liver, an effect that was reduced upon switching to a candidate modified risk tobacco product or cessation [Lo Sasso et al. DOI: 10.3109/08958378.2016.1150368]. These molecular changes were substantially reduced in mice exposed to a candidate modified risk tobacco product or following smoking cessation.