Basic Information

Symbol
HAPLN1
RNA class
mRNA
Alias
Hyaluronan And Proteoglycan Link Protein 1 CRTL1 Cartilage-Linking Protein 1 Proteoglycan Link Protein Cartilage Link Protein Cartilage-Link Protein Cartilage Linking Protein 1 CRT1
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis Mechanical injury analysis

MANE select

Transcript ID
NM_001884.4
Sequence length
4849.0 nt
GC content
0.3568

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1150.80 kcal/mol
Thermodynamic ensemble
Free energy: -1248.63 kcal/mol
Frequency: 0.0000
Diversity: 1508.58
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((.((((.......)))).......(((((((((((...((((.((..((((.((.((.((((.((((((((((..((....)).)))))))))).))))..)).)).))))..))..((((((((((((.((((..((((((.........))))))..)))))))...........))).))))))..(((((..((((((.((((((((((((.............)))))))))).))))))))............))))).......((((.((...(((..(((.....))).)))..)).))))((((((((...(((.......)))...))))))))......))))..)))))))))))(((((((((((..............)))))))))))..(((((((.(((.((((.((((((((((((..........))))))))).....))).)))))))))))))).........)))))).)))))((.(((((...((((((((.....(((((...((((((((..((.((((((..(((..(((((....))((((((((((((.((..(((((((((((((.((...((((.((((((((((((..((((((((.(((...(((..(((.((((((....(((.((((((((..(((.(((.((((.(((((((.(((((.....)))))))))))).(((((((..............)))))))....((((.((....)).))))(((((........)))))(((.(((((((..((((...(((((((...(((.((((((((..........))))))))..)))..)))))))...))))..))....)))))))).)))).))).................))))))).)))).))).....)).)))).)))....)))....))).)))))))))))))))((((....((((((.(((((((.(((.(((....((((((.(((((((((....))))))))).))........))))..((((((((((((((((....).))))))))))).)))).((((...)))).......(((....)))(((.((((.(((((((((...((((........((((.((((((((((.((((.(((((..........((((((((.......))))))))............))))).)))).((((.....))))((((......((((((((.....))))))))......))))..(((((((....)))))))(((((....)))))............(((((((.....)))))))......((....((((((.((......)).))))))....)).((((((((((..((((((......((........)).....))).)))..))))))))))...........((((((..((....(((((((((((((((((.....)))).....(((((((.((((((....)))).)).))))...)))..............(((((((......((((((((((..(((((........((((((((.............))))))))...((((............)))).....)))))..)))))))))))))))))((((((...((((((.....)))))).)))))).............................(((((((....)))))))...........((.(((((((((((.........((((((.((........)).))))))...........................((((..............................))))..)))))...)))))).))..)))))))))))))....))..)))))).))))))))))))))))))))))))....))))))))))))).))).))))))).......((((((((................)))))))).((((((((((((.....((((((((((((..(((...((((......))))....))).))))))))))))........))).)))))))))......(((((((((((....(((((.((((.....((........))....)))))))))))))).))))))......)))))).......))))(((.(((((((((((((((((.((.....((((((..........((((((.........(((((.((((((((((((.......).))).))))))))(((...........)))..(((.(((((.(((((.................((((((((((..(((((((((.(((...(((......................))).)))..)))))).)))..))))))))))..........)))))))))).)))......)))))(((((((..(..((((.......))))..)..))))))).((((((...))))))............))))))..)))))).......((((((..(......)..)))))).((((((....))))))..)))))))))))))..)))))).))).........))))).)))))))))))))).)))......(((((((((.....................)))))))))))..)))))))))))).)).))).)))..))))))))..))))))))....)))))...........((((....))))..........)))))))).(((((((....(((((.(((((((((......((((((((((.....(.((((.((((((..(((((.((.((((((((((((.(((((..(((((.((((.....(((((.........(((((((.......)))))))........)))))....))))...)))))..)))))....(((......)))..((.((((......)))).)).......((((((..((((.....)))).........))))))..(((((....))))).))))))...))))))..)).)))))...))).))).)))).).((((((.((....((((.......)))))).))))))......)))))))))).......))))))))).)))))((((((.((((((((.((((((((((((((((((((....................))))))))))(((.(((((....)))))..)))..(((((((((((....((..((((((..((((...((((((...............))))))...................((((....)))).((((((((((...........)))))))))).((((((((..((((((((........((((((......))))))....(((((((..(((....(((..(((((.......(((((.....................((((((((((.((((((((((((((..((..(((((...(((((....(((......))).)))))...))).))..))..))))).......((((..(.(((((..(((......(((.....)))......)))..)))))).))))(((..((((...(((........)))....))))..)))..((......))..........)))))).....))).))))))))))...((((.....)))).......(((....)))........)))))..........)))))..))))))..)))))))((((.((((....)))).))))..((((((.(((...))).)))))).......((((....))))(((((......))))).......)))))))).....))))).)))......)))).))))))..)).....)))))))))))....)))))).))))))))))))(((....))).........((((((....))))))))))))((((((((((((((((.((((........((((((((.............))))))))......)))).))))))(((......)))...........((((...))))))))))))))....((((.(((((((((......))))....))))).)))).((((.(..(((((.((((.....)))).))).))..).))))....)))))))...................))))).)).(((((((((((....(((((.((((((((...(((...((((...(((((((((((..(((((((..(((((((..........(((((.(((((.....((..(((((((.(((..(((((((.((((.....))))))).))))((((..(((..((((((....)))))).)))..))..)).....))).)))))))..))...))))).))))).....((((((.((........)).))))))...))))))).)))).)))((((((((......)))))))).............))))).)))))).............((((((((((.(..((((..((((.(((((.................(((((..((........))..))))).........((((((((..(((((......................)))))..)))))))))))))))))....))))..).))))))))))...)))).))).))))))))...)))))....)).)))))))))....
Thermodynamic Ensemble Prediction
{{(((((.{((((((({{......((((((..{((((((((((.({{.((((({...|))))}.....((((.((((((((((..((....}).)))))))))).))))}}).}))})}..,}))}}||}|||||||||.(({((((({,{.......,,(((((........))))).,,,..{({((({.{{{{....(((((((({(((,{{(((((({(({.,,,..,,....,}||}}}}))}..|{|((((({.......,.))))}}.}....,{{{{.{{,,,{{{..{((.....))).}})..)),)))}{(((((((.,.(((.......))).,.)))))))}.,,....}}}|})))))||,,..(((((((((((..............)))))))))))..(((((((.(((.((((.((((((((((((..........))))))))).....))).)))))))))))))),,,,{((({(({((,,,,,,,,(((((((.((((((({.{{,...(((((,..((((((((..((.((((((..(((..(((,,....}},.(((((((((({{(.{({(((((((((((.{{...((((.((((((({(({{{{(({(((({.{{|||,|{{||{{.,|((({|{{.,{,((((((,,.,..((({(,|.||||}|||||||.{{(({,,..,}))|||||||||.(((((((,..{{,,.......}))))))..}}||||.,|,,||||||||}||||{,..,,,,,))))|(({{(((({{{..((((,,,(((((({...(({.((((((((.,......,.))))))))..}))..}}}}}}}.,,||}|..,,..,{||||,|||{{,,,.,{{{.(((({({{{.{{{{.(({||....))),)),}},,}.)})),).)))).}}).,...))))},)))))),}}}}}||{((({...,{{,{{,.,,||.((((......)))},.,((.(((((((((....))))))))),}},,.,||,||||{{.((((((((((((({((,...,,))))))))))).)))).|||{||{|||}||,,.,,(((,,,,|||{{,{(((({{{,{{(({.,,,}}|||,.{(((({{(((((,....}.))))))))))}...........((((((((.,...,.))))))))..,..,....,,||||||||||.{{{{.....,,,|((((......((((((((.....))))))))...,..))))}.(((((({....}))))))(((({..,.}}}}}........,{{.(((((((.....))))))).}},..,|||||((({((.{(.,,,..}}.})}}}|.......{(((((((((..((((((...,.,{....,.,...},....))).)))..)))))))))}...,,,(((((,(((,,{{(({,..((((((((((((((({..{{,,{{{,.....({{((((.{,((({....}))).,,.})))...)))..............(((((((......((((((((((..(((((........((((((((..,,....,....))))))))...{(((,...........)))).....)))))..)))))))))))))))))((((((...((((((.....)))))).)))))).............................(((((((....))))))),,,,...,,..,{,{{{{{{{{{((.,,,,....,,||||.||..,,.,..,..,|||||,....,....,,|||,......,,...(({,.......,,.|||....,,,.........,))}}..))))).,,)))}}}.})))))))))))))))).{{{||{,||||.,.||||,,{|||}},,{((({{{.,,,.,})}))},,,.,{{..((((((({{,...||,,,|||||,(({{{{,{{.{{{{.....,,,)))).,{{{||||||||},,,.((((((((((((..{({...{{({......}))}....))}.)))))))))))}........}}},)))))))},......,{,,,.(((,,..}}},{{{.||||....}|}}}}},}}},.....))))))))),)))),|||||,.....,}}}},,..,{{{{{({|...,||{|{|||||((({.{{{,,.,{,,,,..||},,...,}},.}}}},,|||.,...||||||(((((((({(({.......}.))).))))))))|{|,,.........}}}|||||,||||,.,{{{{,||||...,,},.,},,((((((((((..{{{((((({.{({...(((......................))).)))..)))))).)))..))))))))))..,,,,,.,}}}},})))))}))}}|},|}}}}},|||((((..{..((((.......))))..}..)))),}||(((({{,..}}}))),}|||......,}}||||{.,,,.....,},,}.||||,|,|..}}},}})))))},,((((({....}))))),||||||,,}}|}||,.,,}}}},),....}}}}}}))))).)))}))))))))))},))......{((((((((.,{{,........,,},,...))))))))))},,,))))))))))).,,.))).)))..))))))))..))))))))..,.)))))...||}.}}..((({....})))......{{..(((((((((((({{{{.......((((((((....)))))))){(((({{.{{{,{((,((.{{{.{{{,,.{{{{{.||||,,,..,{{{{,(((((,.(((((,((,{.....,,{,,.........{||||||,,..,,,))))))}.......})))))}},.})}}.,,)))))}})}))}}}}}}|}.,,..,({,....}||,|.,}|||||||||.....,,,,,,})))))))))}..}}............))))))))))))}.,{{{||||{{..{{{{{{{.{{{{{.|{|{{,,|,||{|||,,..,,,.}}}||||}|{{{,,|{{|({,{{{{{{{{{(((((((({{..,|{{..,,)}}|,,..,{.{{{{....(((((((.((((((........,,,....,.},,.{(((((((((.,..,,.......}},.,..)))))))))},,,.(((((....)))))..,,)))))))))))))}})}.,},,...............{(((((...............)))))}...................((((....)))).((((((((({...........))))))))))|{{(|,,,,....,,,..,.}}},...((((((......))))))........})))))))}}}}}.}}}}}|||,|,.}}}||||{|{{{,,....,..........((((((((((.((((((({((((((..((..(((((...(((((....{{{......}},.)))))...))).))..))..)))))}......((((..(.(((((.{(((......(((.....)))....,.))),.))))),,)))).,,.{(((({{.,(((({.,{{({{,.........,}),,,}.}}})}.)))})}}.,,..,))))).....))).))))))))))...{{((.....)))}.......{{{....}}}........,}}},......,.,,},,.,,,.|}||||,.,,,,,,|..|}||,|,}.})))}.))))}}||||,|}|||}},}},.})}))}.......((((....))))(((((......))))),,|||},},}))}},)))))))),...}})),|{{((({{(,{{({,.,,,,,|||||||}}}}}}.....,{((((((((((.((({.(((....))).})))..))))))))))},..{{{.((((((({(({({,,{{{((((,((((......,.{(((((((...,,,..,.,,,)))))))}.|,.,,}}||,||||}}||||||,..,,...,{{{,,{,{((,{,.{|||||,||||,,.,....{{{{,{{{{{((((......)))),.,,||}}},,})}|||({|{,...}}))||||}}}}.))),.}))}))}.....|},||||}}|}.....,,....,,{{{{{{({{...,{{{................,},,..))}..})}}}}}}.}}}}}}|,,.,,,,{(((((((((((((.,..{((((({........,.{((({.{((((.....((..(((((({.({{,{({{((({,((({.....)))))))},}}}|}}|,.{||..{{{{{{..,.)))))),)}}..,,..,},....})).)))))))..})...}))}}.))))).,,..((((((.((........)).))))))...})))))).}|||,},,{(((((((......)))))))).....,,.,{{{{(((,({..{{{{.............{(((((((((.{..((({..(({{{{{{{{,,,||,....,..,...{{{{{..{{........}}..})}}}.|{.,,...{{{{{{{|..|||||,}....,,},,,,)},,...,})))},..))))))))))))}})))..,,))))..,.}}))))))}}...||||...},,))))}})),,.........}}}}}}))))))}}..

Transcripts

ID Sequence Length GC content
ACUUGAUCUCCAGCUUCCAACUUAAGCAGAACUUGAGAGCAUCCGAACU… 4849 nt 0.3568
Summary

Predicted to enable hyaluronic acid binding activity. Predicted to be an extracellular matrix structural constituent conferring compression resistance. Predicted to be involved in central nervous system development and skeletal system development. Located in collagen-containing extracellular matrix. [provided by Alliance of Genome Resources, Apr 2025]

Forensic Context

A study in humans analyzing heart tissue samples from patients with various structural heart diseases identified a 62-gene expression signature, including the HAPLN1 which was significantly up-regulated (mean fold change 1.7568, adjusted p-value 1.6750 × 10^-14), enabling the classification of diseased versus control samples with approximately 95% accuracy using a random forest model [Fajarda et al. DOI:10.1186/s13040-020-00217-8]. A study in humans demonstrated that the HAPLN1 mRNA was up-regulated by 126% in pericontusional brain tissue from a patient with traumatic brain injury (patient T6) compared to control tissue, as identified via cDNA microarray analysis [Michael et al. DOI:10.1016/j.jocn.2004.11.003].