Basic Information

Symbol
HAS2
RNA class
mRNA
Alias
Hyaluronan Synthase 2 Hyaluronic Acid Synthase 2 Hyaluronate Synthase 2 HA Synthase 2 EC 2.4.1.212
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_005328.3
Sequence length
4240.0 nt
GC content
0.3717

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1048.60 kcal/mol
Thermodynamic ensemble
Free energy: -1137.06 kcal/mol
Frequency: 0.0000
Diversity: 918.24
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.......((((...(((((((..(((.(((((......((((.(((((((((((((.....(.((((...(........((((((((.(((((........))))))))).))))........).)))))....))))..)))))...)))).))))......))))).)))..)))))))..((((((((((((((((((((((((((((....(((..((.(((...))).)).))).((((............)))).)))))))))))))))))))...((((((((.(((((..((((((((((...((((((.(((.((((.((((((((((((((((..((((.(((.((((((..((((((((((((..((((((((..(((((((...(((((...................))))).................(((((((((......((((((((((((...((((((((.(((((((((.((((......((........)).....................((((((((...((((((((((..(((.((........(((((((((.(((((...(((((((((..((((((.((...((....))...)).))))))....(((..((((........))))..))).)))))).))).....)))))))))...(((((((((....))))))..)))........)))))...((.(((((((.....))))))).))....)).)))..))))))))))..(((((((....))))))).............................(((((.........((((((...((.(((((((((.(((...((((.(((((.............)))))..)))).)))..))))...((......))......((((.((((........)))).))))..(((((((.((..........)).)))))))))))).))...)))))).......)))))..(((...((((((((.....)))))).)).))))))))))).)))))))))))))............((((((..........))..((((......))))........(((((.((((......)))).)))))......((((.(.((....))).)))).))))..))))))))((..(((.(((.(((.(((((((.....))))).)).))).))).)))..)).((((....))))((((((.(((..(((((((((((((((((((((((((((((((((((((((((((((((((..(..(((.((...((((((..(((((.((.(.((((((((((..(((..(((((((........)))))))..))))))))))..(((((((.(((((((((((...(((..((((........))))...)))((((((((((.(((((((((...(((((...)))))...))))))))).(((((.......)))))((((.....)))).......((((((.....))))))..))))))))))..................)))))...)))))))))))))............(((.(((...(((((......))))))))..)))..))).).)))))))(((((.(((((...((((....))))...(((.(((((((.....)))).))).))).......(((.....))).........)))))..))))).))))))....)))))..)..)))))))))).))).)))))((((((((((.....((((((.((((((((((.................((((..(((((((((((.....((((((.......(((((((..((((.((((...))))...))))...(((((.(((....((((.((....)))))).....((((((((.((((((((...(((((.(((((((((...(((.((........(((.....)))..)).)))..))))))....))))))))(((((((.......))))))).....(((.(((.((((....)))).))).))).........(((((((...)))))))..)))))))).)).))).))).(((((((((((((.((((....)))).....)))).))))))))).)))))))).)))))))....))))))..((((.(((.(((.((((.....((((....)))).....)))).))))))))))....))))))))))))))).........(((((((......))))))).....)))))......))))))))))).(((.....))).(((....)))(((.............)))...(((......)))...))))))))))(((..(((((((.((((((.((.....)).)))))).)))).)))..))).((((((............)))))).(((......)))......)))).))))))).).))))))).....(((((((.....((((((((.....((((((....)))))).....)))))))))))))))...(((((.((((.(.((((....)))).).))))..........)))))..)))))))))))).))))))))).........))))))))))))))))))))).((((((.((((...((((.((((((.......))))))...))))...)))))))))).)))))))..)))))))))))))))))...)))..))))))............))).))))..))).............))))))))))))).)))).))).))))))............(((((..((((....))))..)))))((.(((.((((........)))).))).))...........((((((.(((((((((((.....)))))))....))))))))))...)))))))))).))))).)))))))).))))))))).((((((((((.((....((((((((....(((((((....)))))))..............(((((((....(((((..(((((((((((.(((((((...((((((..................)))))).............((((((((((....))))...(((((((((..(((((((.....)))))))...(((((((..((((((((((((((((.(..((((((.((((((.((.....(((((.((((((.(((.(((...................(((...(((((((.(((((((((((.(((((...)))))..........((((((((...........(..(((.(((((((((((.((..((..(((......)))....))..))...))))))))))).)))..))))))))).)))))))).....)))..))))))).))).........(((((.(((......))).)))))....)))..))).)))))).))))))).)))))).))))))).))))))))..............((((((((((((..((........(((((((...(((((.(((((((((............))))))))).....))))).)))))))(((((...))))).(((((((((.......(((..((..........))..))).......)))))))))))..)))))))))))).......))))))))..))))))).....................((((......(((((((((((((........)))))...........((((.....)))).))))))))......))))....)))))))))..........)))))).))))))).)))))....))))))((((((((......)))).))))(((((((((..(((((...(((((......((((..........)))).....)))))...)))))......))))))))))))))(((((((.((((((.............(((((((.........)))))))............)))))).))))))).(((((((..............))))))))))))))))))))))))))))).)))))..(((((........)))))................)))).
Thermodynamic Ensemble Prediction
.......((((.{.(((((((..(((.(((((..,...((((.(((((((((((((.....(.((((...,........((((((((.(((((........))))))))).)))).}......,.))))}....)))),,)))))...)))).))))...,,.))))).)))..))))))),.((((((((((((((((((((((((((((....(((.,,(,({...,))).}}.}}}.((((,,.....,,...)))).,}))))))))))))))))))},((((((((.{((((..((((((((((...{(((((.(((.((((.(((((((((((((,,,..((((.(((.((((((..((((((((((((..((((((((..(((((((,{{(((({{{,,.,.{{{{{{{{{{{.,.,,,......}}}}}}}}}}}{{{|||{{,,}}}},|||{{{((((((...((((((({..,,,,(((({(((({{.{{{(({{{.{{{{(|....,,,.,,....,|...,.((((((((...((((((((((..(((.((......{,{,,,,((((,(((((...(((((((((..((((((,{,.{,({....},,}}..,))))))...,(({..((((......,,)}}}..))).)))))).))).....)))))))))...{{{{(((((....)))))}..,,,...,,.,.}}})),..({.(((((((.....))))))).}}....)).)))..))))))))))..(((((((....))))))).........,,..................(((((.........((((((...((.(((((((((.(((...((((.(((((.............)))))..)))).)))..)))),,,(((,...}))).,,,.((((.((((........)))).))))..(((((((.((.,.....,,.)).)))))))))))).)).,.)))))).......)))))..,{{...((((((((.....)))))).)).,}))))))))).)}|||||||||||............||||{{.....,....}}..{(((......)}}}......,.,,|||,.,,|.)}}},,)))})))),..}}))||,{.,.,{....||,.,,}},}}|,.,||||}|||(({{(((,(((,({{.{{{{{||,,,,,))})),)).}}},)),,)))}.}}|,{||,.,,))}|((((((((((..((((((((((((((((((((((((((({(((((((((((((((((((((..(..(((.((...((((((..{{{{,,{{.{,((((((((({..(((..(((((((........)))))))..)))))))))|,,(((((((.(((((((((((((,{((..((((........))))...))){(((((((({.(((((((((.{.(((.,...{((({{....,,(((....))},,,...,})))))..,,.))}.}.)).))))),{(((((.....)))))}|})))))))))}.......,}.}}...)),)))))...))))))))))))).,||.,,,,,,.{{{,(((...(((((......)))))}}}.,)}).,}}}.}.))))}})(((({.,..,({{,(({(({{{{{{{{.......||||||,.,}}),}}|,||.||,..,,...(((.....))).........)))))).}}))).))))))....)))))..)..))))))))))},)),})))){(((((((((....{((((((.((((((((((............,,{{.((((..(((((((((((.,...((((((.......(((((((..((((.((((...))))...))))...((({(((((....(({((((....)))))}.....((((((((.((((((((...(((({,(((((((((..,,{{.,.........(((.....))).,},.))}..))))))....))))))))|((((((.......)))))),.....(((.(((.((({....)))).))).)))......,,.(((((({...})))))))})))))))).)).))).))).(((((((((((((.((({....}))}.....)))).))))))))).)))))})).)))))))....))))))..((((.(((.(((.((({.....((((....)))).....)))).))))))))))....))))))))))))))).........(((((((......))))))).,...)))))......))))))))))},|.{,,,.,||}.{{{....}}}{{{,|,,,||,,....,,....|||,.....,}}...)))))))))|(((..(((((((.((((((.{(,,...)),)))))).))))}}))..))),((((((............)))))).{{{......))).....)))}}.))))))).},))))))).....(((((((.....((((((((.....((((({....}))))}.....)))))))))))))))...((,,......}|.,{{{,...|,}|,.,|,,,..,||,,,..,}))),.)))))))))))).)))))))))}..,}}...)))))))))})}}}}}}}))}.((((((.((((...((((.((((((.......))))))...))))...)))))))))).)))))))..)))))))))))))))))...)))..))))))............))).))))..|||{,.....,,,...))))))))))))).)))).))).))))}}............(((((..((((....))))..)))))((.(((.((((........)))).))).))...........((((((.(((((((((((.....))))))}...}))))))))))...)))))))))).))))).)))))))).}}))))))).{(((((((((.{,.,..((((((((....(((((((....)))))))..........,,{,.((((((,...{((((..{((((((((((.(((((((...,,{,{{.........,,.......}|}}}}|,....,...,..((((({((((....))))...(((((((((.,(((((((.....))))))),..(((((((..((((((((((((((((.(..(({{((,((((((.((....,(((((.((((((,(((,{{{.,{{{.{{.,,........(((.,,||,{|{|}({{(({{{{{{.{((({...))))}..,,..,..,|}||.,||..|||.,,{{.,..(({.(((((((((((.((..{,..{((,,....}}}..},))..,,,,.))))))))))).}))..}.}))}.,,.}))})))).....)))}})}}}}}}.,,,.........(((((.(({......))).)))))....}}}..,)),)))))).))))))).)))))),)}}))},,))))))))..............((((((((((((..((......,.,((((((,,,(((((.(((((({{{............}}))))))),,,..}}}}}.}}}}}}|(((((...})))},(((((((((.......(((..((..........))..))).......)))))))))))..)))))))))))).......))))))))..)))))))..................,{.((((...,..(((((((((((((........))))}...........{(((.....)))),))))))))..,...)))).},.)))))))))..........)))))).))))))).))))}...})))))|((((((((......)))).))))|((((((((.,(((((...(((((......((((..........)))).....)))))...))))).,....))))))))}))))))))))).}}}},,,.,...|{|..,||{((((,.....,,,}}}}},,},............,,,.....((((((,{((((((.{{.........}}))))))))))))).)))))))))}})))).)))))..{{{{,...,,.,,}}}}}...,,,,....,,,..)))).

Transcripts

ID Sequence Length GC content
AGACCCCCUUAAGUUGGAGGAGGCAGAAGGGCAACAACGGCGGGGAAGG… 4240 nt 0.3717
Summary

Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS2 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to glycosaminoglycan synthetase (DG42) from Xenopus laevis, and human and murine hyaluronan synthase 1. [provided by RefSeq, Jul 2008]

Forensic Context

A single-cell transcriptomic analysis in a rat model of radiation-induced lung injury identified the HAS2 as an orthologous rat gene associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357].