| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUUGGAGAGUUAAAACUGUGCCUAACAGAGGUGUCCUCUGACUUUUCU… | 2237 nt | 0.4707 |
The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011] CIViC Summary for HAVCR2 Gene
A study in humans demonstrated that the HAVCR2 is a receptor paired with LGALS9 in the GALECTIN signaling pathway, which is a primary driver of cell-cell communication dominated by classical and intermediate monocytes in patients with acute myocardial infarction with plaque rupture [Jun Qian et al. DOI:10.3389/fimmu.2022.908815].