Basic Information

Symbol
HAVCR2
RNA class
mRNA
Alias
Hepatitis A Virus Cellular Receptor 2 TIMD3 TIM3 Tim-3 CD366 T-Cell Immunoglobulin And Mucin Domain-Containing Protein 3 T-Cell Immunoglobulin Mucin Family Member 3 T-Cell Immunoglobulin Mucin Receptor 3 T-Cell Membrane Protein 3 FLJ14428 HAVcr-2 TIMD-3 T-Cell Immunoglobulin And Mucin Domain 3 T Cell Immunoglobulin Mucin 3 Kidney Injury Molecule-3 CD366 Antigen KIM-3 SPTCL TIM-3
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_032782.5
Sequence length
2237.0 nt
GC content
0.4707

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-718.40 kcal/mol
Thermodynamic ensemble
Free energy: -756.05 kcal/mol
Frequency: 0.0000
Diversity: 568.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.(((((((((((..(((...((((((...))))))..((((((.(((..((((((.(((...((((((((....(((...(((....((.((....)).))...)))...)))((((.(((.(((.(((..((((((.(((((..((((((.(((.......((((((.((((((..(((((((((..(((((......(((((((..(.(((((((...(((((((((((((.((....((((....))))...)).)))))).........((((((..........)))))).(((((.((((....((((((((((.....))))....)))))).....(((((.......)))))((((.((((((...)))))))))).(((((.........(((((......((((((..(((((......)))))..))))))..(((((..((((...((((((.((((....((((.((....)).)))).(((((((...((.((((.....((((((.....(((((..(((...........))).)).)))((((.(((((.............)))))..((((((((((((((((....)))))...)))))))))))......)))))))))))))).))....))).)))).......)))).))))))))))..)))))((((((...(((((((..((((((((.(((..(((((((.((((((........((((((((.((...............)).))))))))((((((((.........))).)))))...(((....)))(((.(....).)))...(((.....))))))))))))))))))))))...)))))...))))))).....((((....))))..)))))).((((((.(((((((...........))))))).)).)))).)))))...))))).((((.((((....))))..))))(((((..........)))))....))))))))).((((...(((((((.(((((((((.((.(.((((((((((..((((((.........))))))..)).))).))))).)..)).)).))))))).))..)))))....))))(((((((...(((.(((((..(((((....(((((.......(((((.........)).))).......))))).....)))))....)))))..)))......)))))))))).))))...))))))).)....))))))).((((......)))).(((((((.....((((......))))...)))))))(((((.....)))))..(((((((((((...(((((((.(((.((((((....)))))).))).)))))))...))))))))...((((..((((..(((((.((..(((((((.(((((((((.((((.(......))).)).)))..))))))...))))))).)))))))..))))...)))))))))))).)))))))))......((((((......))))))((((......))))........)))))).)))))).....))).)))))).(((((((((((....((((............(((......))).(((((......)))))...))))..))))..)))))))....(((((.((((((((....))))).))).)))))..(((((...(((.((((((.((.(((((...))))).)))))))).)))...))))).(((((((((((......).))).).)))))).....))))))))))).)))))).))).))))((((....)))).)))))))))))))))))..)))))))))....(((((((.........))))))))))..)))))).((.(((((((((((((((............(((((..((((((......((((((..(((..(((...((((((......))))))..)))..))).((((.......))))(((((((((...((((((....))))))...........))))))).))))).)))....))))))..)))))............)))))))..(((((((((..((....))..))))))....)))...(((.....))).........)))))))).))))))).))))).................
Thermodynamic Ensemble Prediction
.{((((.((((((((((({.(((...((((((...))))))..((((({{(((..((((((.(((...((((((((.,,(((({(((,{,((({(((((,(((,,{{{,((,({,...,|,,..,.,,,)))))...,)))}})))}||.}||||||,,,{,,.....((((((.((((((..(((((((((..(((((......(((((((..,.(((((((..,{{{{{{,((((((.((....((((,,,.}}))...)).)))))}.......,,((((((.......,..))))))......{{{{{,.,,((((((((((.....))))),..,})))}|.,,.(((((.......)))))((((.((((((...)))))))))).((({....}}}},,(({{{......((((((..(((({......}))))..)))))}..((((({.{(({{..((((((.((((....((((.((....)).)))).(((((((...((.((((,....{((((({....(((((..(((.,.......,.))).)).)))||||,((({,.............,}}}}..((((((((((((((((....)))))...)))))))))))......}},,,})))))))).)).,..))).)))).......)))).))))))}}})},)))})|||||(,,.(((((((..((((({{(.,{,..((((({{{((((((........((((((((.((..,.........,..)).))))))))(((((,,(,,.......,)),)))))...(((....)))(((.(....).))),{,,{,.....)))))))))))))))),},}))...)))))...))))))),,,{|{|{,.,,,))||,,|,}}}}.((((((.(((((((...........))))))).))}}})).,))))}}}},,,,.,,{,.{{{,..,,||||.{||||{(,,,({{{{.{{{||...{{{{{{||,.{(((..((({.{(({,.,((((((((((((({......}))}|)))}|||||||||...|||)..))),.,).))},.}))).,.,}))),.))))),,|))||}}.}}}}},,|{(((......))))|||||,,,,,,}|||}})),||,.,},...(((((((((.(...(((,({(({(.(((((((....))))))}.}}},.,..,,,..,,}}.)))...).))))))))).))))))).}....))))))).{{{{..,,..}})}.(((((((.,...((((......))))..,))))))){{{{(.....}}}}}..{{{((((((((...(((((((.(((.((((((....)))))).))).)))))))..,))))))))...{(((..((((..(((((.((..(((((((.(((((((((.((((.(......))).)).)))..})))))...))))))).)))))))..))))...))))))}})))).)))))))))......((((((......))))))((((......))))........)))))).)))))).....},},||||}},({({(((({{,..,.{{{|,,}.,,......({{.,,...})).(((((......)))))...}))),}}}}),,}}}}}|||,.,(((((.((((((({....))))).))).)))))..{((((...(({.((((((,((.(((((...))))).)))))))).)))...}}}}}.(((((((((({......).))).)}})))))..((((((.{....(((({......),))))......}.)))))))))))))))))))))))..))))))))}....{((((((......,,.))))))})))},))))))}|{.(((((((((((((((............(((({.{((((((....,.((((((.,{{{..(((...((((((...}}})))},)})})},{{{|{{.,,....,}})))}(((((((((,..((((((....)))))).....,},...,}))))).))))).)))....)))))},})))))............)))))))..(((((((((..({....))..))))),...,)))...{((.....))),,.......)))))))).)}})))).))))}.................

Transcripts

ID Sequence Length GC content
AUUUGGAGAGUUAAAACUGUGCCUAACAGAGGUGUCCUCUGACUUUUCU… 2237 nt 0.4707
Summary

The protein encoded by this gene belongs to the immunoglobulin superfamily, and TIM family of proteins. CD4-positive T helper lymphocytes can be divided into types 1 (Th1) and 2 (Th2) on the basis of their cytokine secretion patterns. Th1 cells are involved in cell-mediated immunity to intracellular pathogens and delayed-type hypersensitivity reactions, whereas, Th2 cells are involved in the control of extracellular helminthic infections and the promotion of atopic and allergic diseases. This protein is a Th1-specific cell surface protein that regulates macrophage activation, and inhibits Th1-mediated auto- and alloimmune responses, and promotes immunological tolerance. [provided by RefSeq, Sep 2011] CIViC Summary for HAVCR2 Gene

Forensic Context

A study in humans demonstrated that the HAVCR2 is a receptor paired with LGALS9 in the GALECTIN signaling pathway, which is a primary driver of cell-cell communication dominated by classical and intermediate monocytes in patients with acute myocardial infarction with plaque rupture [Jun Qian et al. DOI:10.3389/fimmu.2022.908815].