Basic Information

Symbol
HBA1
RNA class
mRNA
Alias
Hemoglobin Subunit Alpha 1 HBA-T3 Hemoglobin Subunit Alpha Hemoglobin, Alpha 1 Hemoglobin Alpha 1 Globin Chain Hemoglobin Alpha Chain Alpha-2 Globin Chain Alpha Globin Chain Alpha One Globin Delta Globin Alpha-Globin METHBA ECYT7 HBH
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_000558.5
Sequence length
577.0 nt
GC content
0.6447

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-217.30 kcal/mol
Thermodynamic ensemble
Free energy: -227.65 kcal/mol
Frequency: 0.0000
Diversity: 120.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((......))).))))((((...(((....)))...))))(((((.((.((((.....((((((((((..((((((....(((.(.(((.(..((.(((...((.((((((((((.(((.((((...)))).)))..........................((.(((.(((((((((....)))).....))))).)))))...(((((((((((((((.......(((((...(((((((.(((.((.....)).))))).))).)).((((((((.((((....(((....)))...)))).))))))))..))))).......(((((.((((((.(((((((.(((((.(.((((.............)))).).)))))...)))).))).........(((.....)))))))))..).)))).....(((((.(((((.............)))))..))))))))))).)))))))))....)))))))).....))))...))).))..).))).)))))))))).)))).)))))).....))))..)).)))))..
Thermodynamic Ensemble Prediction
.,,,.(((((((......))).))))|||,,,{{{,...}))}...}}}}(((((.((.((((.....((((((((((..((((((....(((.(.(((.(..((.(((...((.({((((((((.(({,((((,..,}}),))),,............,...........((.(((.(((((({((....}}},.}}.}))))).)))))...(((((((((((((((,.{{.(,({{((..,(({((((.(((.((.....)).)))))},)),)).((((((((.((((....(((....)))...)))).))))))))..||}}}.,.....(((((.{(((({.{((((((.(((((.{.((((.,...........)))).).)))))...)))).))}.{{......(({.....}))})))}}..),)})),}}},|{{{{,|{{{,......,....,,))))),.,))}))))))).)))))))))....)))))))).....))}}...))).))..).))).)))))))))).))))))))))).....))))..)).)))))..

Transcripts

ID Sequence Length GC content
ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACCAUGGUGCUGUCU… 577 nt 0.6447
Summary

The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

Forensic Context

No relevant information is available at the moment.