| ID | Sequence | Length | GC content |
|---|---|---|---|
| GAGCCGAUGCCCGAUUCCGCGCCCGCCAUGGCCGACAAAAUGGACAUGU… | 1097 nt | 0.5743 |
The protein encoded by this gene is a heat stable, nuclear protein and functions as a molecular chaperone. It is thought to regulate dimerization, DNA binding, and transcriptional activity of basic region-leucine zipper (bZIP) proteins. [provided by RefSeq, Jul 2008]
A transcriptome analysis of post-mortem human tissues from sepsis patients demonstrated that the ALYREF gene was downregulated as part of the metabolism of RNA pathway in the hippocampus, kidneys, and lungs during sepsis [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].