Basic Information

Symbol
HBA2
RNA class
mRNA
Alias
Hemoglobin Subunit Alpha 2 HBA-T2 Hemoglobin Subunit Alpha Hemoglobin Alpha Chain Hemoglobin, Alpha 2 Mutant Hemoglobin Alpha 2 Globin Chain Alpha-2 Globin Alpha Globin Alpha-Globin ECYT7 HBH
Location (GRCh38)
16:172876-173710
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Tissue/body fluid identification Time since deposition estimation Individual identification
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_000517.6
Sequence length
576.0 nt
GC content
0.6441

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-219.20 kcal/mol
Thermodynamic ensemble
Free energy: -228.92 kcal/mol
Frequency: 0.0000
Diversity: 124.08
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((......))).))))((((...(((....)))...))))(((((.((.((((.....(((((((((((((((...(((((((.(.((.....((.((((((((((.(..((....(((.((((...)))).)))...))..)))))).....))))).)))).).)))))))((((....))))..))))))).(((((((...(((((.(((.((((.(((.((........))))))))((.(((((.(.....).)).))).)).((((((((.((((....(((....)))...)))).))))))))..(((((.(.....(((((.((((((.(((((((.(((((.(.((((.............)))).).)))))...)))).))).........(((.....)))))))))..).)))).....).)))))..................((((...(((...)))...)))).(((((.((((...)))).))))).......)))).)))))...)))))))...)).)))))).....))))..)).)))))..
Thermodynamic Ensemble Prediction
.,{{.(((((((......))).))))|||,,,{{{,...}))}...}}},(((((.((.((((.....(((((((((((((((,,.(((((((.(.({..,..((.((((((((((.((.((....(((.((((...)))).)))..,))).,))))).....))))).)))).}.}))))))((((....)))),,))))))).{((((((...(((((.(((.(({{{{((.({|,..,...||||}||}((.{((((.,....,),)),,)).)).((((((((.((((....(((....)))...)))).))))))))..(((((.{.....(((((.((((((.(((((((.(((((.(.((((.,...........)))).).)))))...)))).))).,,,.....||{.....}}}))))))..).)))).....}.))))),,.............,,,||||...|||,,,))),..)}}).(((((.((((...)))).)))))......,,))).)))))...))))))}...))))))})).....))))..)).)))))..

Transcripts

ID Sequence Length GC content
NM_000517.6 NCBI
ACUCUUCUGGUCCCCACAGACUCAGAGAGAACCCACCAUGGUGCUGUCU… 576 nt 0.6441
Summary

The human alpha globin gene cluster located on chromosome 16 spans about 30 kb and includes seven loci: 5'- zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 - alpha-1 - theta - 3'. The alpha-2 (HBA2) and alpha-1 (HBA1) coding sequences are identical. These genes differ slightly over the 5' untranslated regions and the introns, but they differ significantly over the 3' untranslated regions. Two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin; alpha chains combine with delta chains to constitute HbA-2, which with HbF (fetal hemoglobin) makes up the remaining 3% of adult hemoglobin. Alpha thalassemias result from deletions of each of the alpha genes as well as deletions of both HBA2 and HBA1; some nondeletion alpha thalassemias have also been reported. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the HBA2 gene, encoding haemoglobin alpha 2, was the second most highly expressed protein-coding gene in whole blood and was identified as a candidate blood-specific mRNA biomarker for body fluid identification via whole transcriptome shotgun sequencing [Jepsen et al. DOI:10.1016/j.fsigen.2024.103089]. This method successfully generated high-quality sequencing data from low-template and degraded blood stains, enabling the simultaneous detection of such biomarkers for donor identification within the identified body fluid. A study in human aged bloodstains demonstrated that the HBA2 is a highly stable blood-specific mRNA marker, with detection rates exceeding 80% in 50-year-old samples and over 90% in 30-year-old samples, proving mRNA profiling effective for identifying aged blood [Zhao et al. DOI:10.1016/j.forsciint.2017.01.006]. Another study using real-time PCR on human samples confirmed the HBA2 is highly specific for blood, showing expression levels at least 10-fold higher in blood than in saliva and 1000-fold higher than in other fluids, with stable detection in samples stored at ambient temperature for extended periods [Nussbaumer et al. DOI:10.1016/j.forsciint.2005.10.009].