Basic Information

Symbol
HBB
RNA class
mRNA
Alias
Hemoglobin Subunit Beta Beta-Globin CD113t-C Hemoglobin, Beta Hemoglobin Beta Subunit Hemoglobin Beta Chain Beta Globin Chain Hb Monza Protein ECYT6
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000518.5
Sequence length
628.0 nt
GC content
0.5127

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-224.20 kcal/mol
Thermodynamic ensemble
Free energy: -235.01 kcal/mol
Frequency: 0.0000
Diversity: 82.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....(((((..((((((....))).)))..))))).......((((..(((.(((((.((...((((...))))..((((((..(((((((((....))))..)))))..))))))((((((((((((((((...(((((((.((((((((((....(((((((.(((((((((((...))).))))))))....(((((........((((......))))......((((((((((.(((.((...((((.((.....)))))).)).)))))))...)))))))))))...)))))))...((((((((....(((((((((((((...(((.((((((.(..(((.(((((.....))))).)))..))))....))).)))...)))).)))...))))))))))))))........))))))..)))).)))))))......(((((((.((.(((.(((((......)))))))).)))))))))..........)))))))).)))))))).....(((((.((((((((((((.(((...........))).)))))....))))))))))))))))))))))..))))..............................
Thermodynamic Ensemble Prediction
....(((((..((((((....)))}}))..))))).......((((..(((.(((((.{{...((((...))))..((((({,((((((((((....)))),.,)))),)))))))((((((((((((((((...(((((((.((((((((((....(((((((.(((((((((((...))).))))))))....(((((,.......{{{{.....,)))}..,...((((((((((.(((.((...((((.((.....)))))).)).)))))))...)))))))))))...}))))))...((((((((....(((((((((((((...(((.{(((((.({.(((.(((((,...,))))).)))...})}....))}.)))...)))).)))...))))))))))))))........))))))..)))).)))))))...,..(((((({{((.(((.(((((......)))))))).)))))))))......,},.}))))))).)))))))).....(((({{((((((((((((,(((...........}))})))))}...,,))))))))))}}))))))))..))))...,{{,{,.....,,,,},..........

Transcripts

ID Sequence Length GC content
ACAUUUGCUUCUGACACAACUGUGUUCACUAGCAACCUCAAACAGACAC… 628 nt 0.5127
Summary

The alpha (HBA) and beta (HBB) loci determine the structure of the 2 types of polypeptide chains in adult hemoglobin , Hb A. The normal adult hemoglobin tetramer consists of two alpha chains and two beta chains. Mutant beta globin causes sickle cell anemia. Absence of beta chain causes beta -zero-thalassemia. Reduced amounts of detectable beta globin causes beta -plus-thalassemia. The order of the genes in the beta -globin cluster is 5'-epsilon -- gamma-G -- gamma-A -- delta -- beta --3'. [provided by RefSeq, Jul 2008] CIViC Summary for HBB Gene

Forensic Context

A study in humans demonstrated that the HBB mRNA is a highly stable blood marker, successfully detected in all 23-year-old blood stains across eight problematic carrier materials, even in samples that failed to yield full DNA profiles [Kohlmeier & Schneider DOI:10.1016/j.fsigen.2011.04.007]. Subsequent research developed a rapid reverse transcription-recombinase polymerase amplification (RT-RPA) assay for the HBB, which detected it from approximately 10^-3 μL of blood and showed high tolerance to common inhibitors, supporting its use as an effective screening tool prior to definitive blood identification [Kubo et al. DOI:10.1016/j.fsigen.2022.102808]. A study in mice demonstrated that the HBB is a highly sensitive and specific marker for blood identification, detectable in stains as small as 0.001 μL and in aged samples up to 37 years old [Matsumura et al. DOI:10.1111/1556-4029.13045]. In human forensic samples, it was exclusively detectable in methamphetamine hydrochloride-mixed blood where other mRNA markers failed, and its expression, though impacted by UV and humidity, remained robust against detergents and disinfectants.