| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACACUUUCUUCUGACAUAACAGUGUUCACUAGCAACCUCAAACAGACAC… | 620 nt | 0.5065 |
The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the HBD is an mRNA marker for circulatory blood detection, showing high abundance and specificity to samples containing blood, including its presence in menstrual fluid, with a statistically significant increase in sensitivity compared to a well-known marker [Albani & Fleming DOI:10.1016/j.scijus.2017.09.002]. Further developmental validation in a multiplex system confirmed the HBD as a component for circulatory blood identification, demonstrating successful detection at approximately 0.05 µL and amplification from some non-human species, with the overall system showing improved performance on case-type samples [Albani & Fleming DOI:10.1016/j.scijus.2019.01.001].