Basic Information

Symbol
HBD
RNA class
mRNA
Alias
Hemoglobin Subunit Delta HBK Hemoglobin Delta Chain Hemoglobin, Delta Delta-Globin Chain Delta Globin Delta-Globin
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_000519.4
Sequence length
620.0 nt
GC content
0.5065

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-205.60 kcal/mol
Thermodynamic ensemble
Free energy: -217.96 kcal/mol
Frequency: 0.0000
Diversity: 161.04
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.((((((((....(((.....((((((((...............(((((((((.((.(((((((((((((((...........((((((.(((((.....((..((((...(((((....((.((((((..(((.((((((....)))))).)))..)).(((((((((((...))).)))))))).......)))).))....)))))))))..))..((..((((((((((.(((.((..((((((((...)))))))).)).)))))))...))))))))....))))))))))))))))))))))..)))).)).)))))))))......(((....(((.(((((.....))))).)))...)))...))))))))..)))((.((((.(((....(((...((......)))))....))).))))))...)))))))).))))(((.(((.(((((......)))))))).)))....(((((...((((((.((((.((..........)).)))).....(((((.((.(((........))))).)))))....((((((.......))))))(((....)))...........)))))))))))
Thermodynamic Ensemble Prediction
.((((.((((((((,,,..,,||||.{{{{{{{,........,,.,,,,(((((((((.((.((((((((((((((((({((,|{{{.(((((....))))}...}},.||,,...}))}}.{{.(({,((((({{((,.,,,,,.}}}}.)))))}))),.|{{(({,{{|||||...,,|,||||||||{...{{{||||....,,{{{{.,...,}})}.,,,..((((((((((.(((.((..((((((((...)))))))).)).)))))))...))))))))})}.)))))))))),)))))))))))..)))).)).)))))))))......{((,{,,(((.((((({...,))))).))),},)}}.}})))))))),.}}}{{.((((.(((..{{(({...((......))}},}}},))).)))))}...)))))))).)))){((,(((,(((((......)))),))).}}},}},{((((...((((((.{(((.,{..........||,||,|.....{((((.((.(((........))))).)))))....((((((.......))))))(((....))).......,,,.)))))))))),

Transcripts

ID Sequence Length GC content
ACACUUUCUUCUGACAUAACAGUGUUCACUAGCAACCUCAAACAGACAC… 620 nt 0.5065
Summary

The delta (HBD) and beta (HBB) genes are normally expressed in the adult: two alpha chains plus two beta chains constitute HbA, which in normal adult life comprises about 97% of the total hemoglobin. Two alpha chains plus two delta chains constitute HbA-2, which with HbF comprises the remaining 3% of adult hemoglobin. Five beta-like globin genes are found within a 45 kb cluster on chromosome 11 in the following order: 5'-epsilon--Ggamma--Agamma--delta--beta-3'. Mutations in the delta-globin gene are associated with beta-thalassemia. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans demonstrated that the HBD is an mRNA marker for circulatory blood detection, showing high abundance and specificity to samples containing blood, including its presence in menstrual fluid, with a statistically significant increase in sensitivity compared to a well-known marker [Albani & Fleming DOI:10.1016/j.scijus.2017.09.002]. Further developmental validation in a multiplex system confirmed the HBD as a component for circulatory blood identification, demonstrating successful detection at approximately 0.05 µL and amplification from some non-human species, with the overall system showing improved performance on case-type samples [Albani & Fleming DOI:10.1016/j.scijus.2019.01.001].