| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCGGCCGAAGGAGCUACGCGGGCCACGCUGCUGGCUGGCCUGACCUA… | 2358 nt | 0.5055 |
Enables growth factor activity; heparin binding activity; and transmembrane receptor protein tyrosine kinase activator activity. Involved in several processes, including epidermal growth factor receptor signaling pathway; positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction; and positive regulation of wound healing. Located in cell surface. Is active in extracellular space. Implicated in glomerulosclerosis and perinatal necrotizing enterocolitis. [provided by Alliance of Genome Resources, Jul 2025]
A study in human corpus cavernosum tissue demonstrated that the HBEGF is a specific marker for the PI16+/FMO2+ FB3 fibroblast subcluster and that its expression pattern and spatial localization are similar to PI16 in FB3 and FB5 [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In functional experiments, the HBEGF showed a strong inhibitory effect on endothelin releasing from fibroblasts, and its expression was upregulated in human and rat skin following UVB-induced inflammation, with a fold change of 24.4 in human skin and 4.5 in rat skin [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in rats demonstrated that the HBEGF was significantly upregulated in striatal microglia/macrophages at 2 hours and downregulated at 3 days following a binge methamphetamine regimen [Kays et al. DOI:10.3390/brainsci9120340].