Basic Information

Symbol
HBEGF
RNA class
mRNA
Alias
Heparin Binding EGF Like Growth Factor HEGFL DTR DTS Diphtheria Toxin Receptor (Heparin-Binding Epidermal Growth Factor-Like Growth Factor) Diphtheria Toxin Receptor (Heparin-Binding EGF-Like Growth Factor) Proheparin-Binding EGF-Like Growth Factor Heparin-Binding Epidermal Growth Factor Heparin-Binding EGF-Like Growth Factor DTSF
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_001945.3
Sequence length
2358.0 nt
GC content
0.5055

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-801.70 kcal/mol
Thermodynamic ensemble
Free energy: -844.90 kcal/mol
Frequency: 0.0000
Diversity: 741.00
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
....((..(((((((((..((((......)))).(.((((((.((((((((((((((.((((....)))).))).(((..((((((((............)))))......)))..))))))))))))))..)))))).)..((((.(((((..((((((((.....)))).((((((.((....))..))))))))))..)))))))))((((((((.(((((.((.((((((........((((.((.(((((........))))).)).)))))))))).)).)))).).).))))))).)))))))))..(((.(((..((((((.((........)).)))))).))).)))(((((.((((.(((((...(((((....)))))..((((.(((.....((((....))))....((((((.((....)).)))))).))).))))..)))))(((((((.((((((((.......).))))))).)))))))......)))))))))....(((((((((...((...((.((((.(((((.(((.........((((.((((.((((.(((((((...((((((((...(((((.(......).)))))(((((((((...((((...(((....)))...((((((...)))))))))).(((((.((((((..(((((..((((......((((((((((.(((((.(((....))).....)))))....))))))).)))....))))..)))))..))))))...)))))....((((.(((.(((..(((((..((((((....)))))).....).))))..))).)))))))...))))))))).....((.((((((.....((((((((.......((((((....((((((((.((...((((..(((..(((((((((....(((((((..((.....))..)))))))..)))(((((((((((......)))((((.....)))).((((...(((((.(((((((..((((((((...)))).....((((((.........))))))......((((........))))))))))))))).)))))...))))...((....))(((((.(......))))))....))))))))............(((((..((((((((((((((...(.(((.((((((............((((((((.(((..........)))..)))))))).............))))))..)))).))))).........)))))))))...)))))......................((.((.((((.((...((((..(((((((.(((((((....))))))).)))))))..)).))....((((......)))).)).)))).)))).((((((((..(((.((.((((((((((((((.....)))))))((((((((((.(((((((.((....((((((((((((.((........)).))))).)))))))....)).))).))))..)))))))))).....(((((.(......).))))).(((((....((((((....((((((((((((((....(((((((.(((.((........)).))).)))))))(((((.((...)).)))))(((((...............)))))....((((((.((((((((((.........)))))))))).)))))))))...))))).))))))......))))))((((((((...))).))).))......)))))((((((....))))))))))))).))...)))..))))))))(((((((((...........))))))))))))))))))..))))......))))))))))......)).))))....))))))))..))))))))))))))))........((((...))))(((((...(((((......)))))))))).........))))))).)))))))).))))))).))))).)))).))..))))))))))).((((((((((((.((((((.((((((((...(((((..(((.....((((((((................))))))))(((((....))))).)))..)))))(((.....)))..((((((((...((.((.....)).))..))))))))......((.(((((((...))).)))).))((.....))......)))))))).)))))).)))))).......((((..(((....)))...)))).....)))))).(((........)))..))...........
Thermodynamic Ensemble Prediction
....(((,{((((((({..((((,{,,{,|,|{{({(((({{.((((((((((((((.((((....)))).))).(((..((((((((............)))))}.....}))..)))))))))))))),,)))))){|,.((((.(((((..((((((((.....)))).((((((.((....))..))))))))))..))))))))){|||||{|.|||||,||,(((({,..,,,,.,((((.((.,(((({{{{{{..,||||{||.,}},,|||||{||{,|||{|{,{|||||||,|||}},,,|.|}}}.|||..{{{|||}||}}}.}}}},|{|,,,,)}),)|)))|||||}((,(((((((.{.(((((....)))))..,.}).)))))}}.((({....}}}).,,.{||||,}||...}))})))))).))}})))}...,}},(((((((.((((((((.......}.))))))).))))))).....,})}},,)))....(((((((((...((...((.((((.{((((.(((.......,.((((.(((,,((((.(((((({,..((((((((...,{{,,.{......}.{{((,..(((((..(((((((.,{(((....,||,..((((((...)))))){{{{{((((({((({...,{,,.{({{{(({{{{((((((,((((({.((,,.(((....)))...}})))))}}}}))),||,|((((.{(((((((((((...,{{||{.,,((((,.{,{({{{.,{{.{{{,.{{{{{..{(((((,...)})))).....}.))))..}}},}||||||.,,|,|((((,..,{({.{{({{((((,(((((((((({,...,{{(({{{({{{,.{,.({{{,,|,}}||||.,|{(,{(((({{(((....(((((((..((.....))..)))))))..)))((((((({,{{.,....,,,{(((.....)))}.((((...(((((.(((((((..((((((((...))))....,((((((........,}}||}}..,,..(({{......}.)))}))))))))))).)))))...))))...{{....)){{(((.,......}))))}}}..}))))))).......,,,,,|||||..{|{{{{(({{,||,...,.{{{.{((((({{.,,..,,..,{{{{{{{{,(((...{{{{{,.,,,{{|||,,||,..........}}.}))})),,,.,}.)))))..,.}}},,}})))}))).,,))))}...,,.,,..,,,{||||,,||,..{({(,,..}}}}.,,{{.,(((((({.((({(({....})))))),|)))))}..}}.|,....{(((......)))},}||||{{{,,,,.,|{(((((..,,,..|}||||{||,{{((((,{{{{,}},,,,|||||||||{,||{{{{{.{{....((((((((((((.{{........}).)))))}})))))),,,,)),)))},))).,}}}}}}}},,.......}}|||}||}}}.}}}})}}|||,...,,||||||....,||||||||,,}}}}...|((((,,.,,|}}|..}}}}..,)})))..,))))))})))}}.}}}),.},|||(((((.,,............}})})...}||||||,((((((((({,,,..,.|,}}}}}))))),)))))}}))}..)))))}))))),...,,,||||||(({{(({{.,,|}||,||{{....||||.||.,|||||.....)))))))))}})})))}})),,,|)))}}||(((((((((...........)))))))))},},.||||...|{{{{..{{(,,...,,,)}}.})))),))))})))))))..)))))...))))))))))))........({{(,,.)))){(({{.,.(((({......}))))}))))........,))))))).)))))))).))))))).))))}.)))).))..))))))))))).((((((((((((.,(((((.((((((((.,,(((((..(((.....((((((((..,.{......,.,..))))))))((((,....})))).)))..))))),((..,,,|||.,((((((((...((.{(.....)).))..)))))))).,,...{(.(((((((...))).)))).))||,,,,,))....,.)))))))).)))))}.))))))......,||,...(((....)))...,,,......))))))..........,.|,,....,}}..,,,...

Transcripts

ID Sequence Length GC content
AUUCGGCCGAAGGAGCUACGCGGGCCACGCUGCUGGCUGGCCUGACCUA… 2358 nt 0.5055
Summary

Enables growth factor activity; heparin binding activity; and transmembrane receptor protein tyrosine kinase activator activity. Involved in several processes, including epidermal growth factor receptor signaling pathway; positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction; and positive regulation of wound healing. Located in cell surface. Is active in extracellular space. Implicated in glomerulosclerosis and perinatal necrotizing enterocolitis. [provided by Alliance of Genome Resources, Jul 2025]

Forensic Context

A study in human corpus cavernosum tissue demonstrated that the HBEGF is a specific marker for the PI16+/FMO2+ FB3 fibroblast subcluster and that its expression pattern and spatial localization are similar to PI16 in FB3 and FB5 [Zhao et al. DOI:10.1038/s41467-022-31950-9]. In functional experiments, the HBEGF showed a strong inhibitory effect on endothelin releasing from fibroblasts, and its expression was upregulated in human and rat skin following UVB-induced inflammation, with a fold change of 24.4 in human skin and 4.5 in rat skin [Dawes et al. DOI:10.1371/journal.pone.0093338]. A study in rats demonstrated that the HBEGF was significantly upregulated in striatal microglia/macrophages at 2 hours and downregulated at 3 days following a binge methamphetamine regimen [Kays et al. DOI:10.3390/brainsci9120340].