| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUCCGAAGUGGCAGCAGCCAGAGAGGGAGUCGGUGUGGACGCGAGGAG… | 1881 nt | 0.5417 | |
| ACUCCGAAGUGGCAGCAGCCAGAGAGGGAGUCGGUGUGGACGCGAGGAG… | 1992 nt | 0.5412 |
Enables RNA polymerase II-specific DNA-binding transcription factor binding activity; protein kinase binding activity; and signaling adaptor activity. Involved in several processes, including granulocyte colony-stimulating factor signaling pathway; positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction; and positive regulation of protein import into nucleus. Located in cytosol; nucleus; and plasma membrane. Part of transcription regulator complex. [provided by Alliance of Genome Resources, Jul 2025]
A meta-analysis in humans identified the HCLS1 as a key hub protein within a neurodegeneration-associated interaction network linked to mild traumatic brain injury, where its deficiency leads to poorer TBI outcome [Matyasova et al. DOI:10.4149/gpb_2021038]. A separate single-cell transcriptomic study in a rat model of radiation-induced lung injury identified the orthologous rat gene for the HCLS1 as being associated with inflammatory processes [Shi et al. DOI:10.17305/bb.2024.10357]. A study in mice demonstrated that the HCLS1 was upregulated after a second-degree scald burn injury, with expression peaking at 3 days post-injury [Feezor et al. DOI:10.1152/physiolgenomics.00101.2003].