Basic Information

Symbol
HCN1
RNA class
mRNA
Alias
Hyperpolarization Activated Cyclic Nucleotide Gated Potassium Channel 1 BCNG-1 HAC-2 BCNG1 Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 1 Brain Cyclic Nucleotide-Gated Channel 1 MUT-M243delinsTL Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 1 MUT-D534H Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 1 MUT-L400P Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 1 Hyperpolarization Activated Cyclic Nucleotide-Gated Potassium Channel 1 GEFSP10 EIEE24 DEE24
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_021072.4
Sequence length
9933.0 nt
GC content
0.4022

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-2903.70 kcal/mol
Thermodynamic ensemble
Free energy: -3092.75 kcal/mol
Frequency: 0.0000
Diversity: 2518.61
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..((.((((((((.((.(((.......))))).))))))))..))....((((((((((...))))..(((.(((......))).)))((((((((((((.....((..((.(((.((.((((((((((.((((.(((((.((((((((((((((((((((((((((.((((((..((((((((((((((.((((((((((((.(.((.((....)).)).).))..)))).))).))).)))))))))))))).)))).((((((((((.(((((.(((((((....))).)))).)))))..(((.......((((((........)))))).)))....(((((..(((((((...(((((((...)))))))..(((((....))))).....((.(((.(((.....))).))).)))))))))..)))))((((..((((((.....)))))).))))..))).))))))))).)))))))))))))))))))))))))).))...((((.(.((((((((((.......((.(((((((((((((.((((((.((.....(((....)))........)).)))))).).)))))))...........))))).)).(((.((((((.((((..(((((((...(((((((((.((((((......(.(((....))).)......))))))...(((((....((((...(((((.........((((....(((((((((((....)))))))))))....((((........((((....)))).......)))).((((.((......))...))))..((((((.(((...(((....))).)))))).)))......((((((((((((((......))))))..((((((..(((((((.....((((((..(((((((...........(((((((((((((.((((.......((.((((((((((((...............(((((((....((((....))))....)))))))......(((((((....(((((((((((((...((((((((((....(((((.(((......)))...)))))......((((.((((..(((.((((((......)))).)))))..)))))))).((((......))))))))))))))))))))))......)))))))).))))..)))))))))))).)).....(((((((((((....))))).))))))......(((((((((((.((......((((..(((((...(((((((((((((..((.(((....)))))..)))))))......))))))...))))).))))((((.(((...))).)))))).)))))).)))))..((((((.....(((((...)))))....))))))((((.((((((((.....((.((....((((..((((((((((((((...)))))))....)))))))..))))...)).)))))).)))).))))..........))))..))))))...)))))))((((((.(((((......((((.....))))...........(((((......))))).((((((.....)))))).............((((((...))))))((((((........))))))(((.((((((((.(((.((((((((....((....(((((((((......((((..(((((.((((((..((((((((.......))))))))(((((......((.((((.((.....((((((........................))))))....)).)))).)).......)))))............)))..))))))))..)))).....)).)))))))..)).....))))).))).))))))))))).)))...))))).)))))).)))))))...)))))))))).)))..)))))).....(((.((((......))))..)))..((((.((((.((((((((...((.((((.(.....).))))...))..........((((((((((((.........))))))))).)))(((((((((............((((........)))).....((((((((...((((.(.(((((.(((((..(((....)))..)))))..................................(((......)))......))))))))))....)))))))).))))))))).....((.....)))))))))).))......)).)))))))))))).)))).........))))).....)))).....))))))))))))))...)))))))..)))).....)))))).))))))))))))).).)))).............))).))))..)))))......(((((..(....)..))))).))))).)))))..))...))..)))).)))))))).(((...((.......)).)))...((.((((........)))).))((((((((..........((.((((((((((.((((((((.............((((((.......))))))........(((((((((((....))))).....))))))(((((((((.....))).(((((((...((((((((..((.((((.(((((..((.....(((((..(((......)))..)))))......))..))))))))).)).((((((((((((........((((((((((....))))(((((.........)))))...))))))........))....(((((((....(((((((((.....(((.......))).((((.......))))..(((((((((..(((.((.....((((((((((........(((((.........)))))...((((((((((((((..(((((......)))))............((((((....))))))..............)))).)))).))))))....((((((((..(((((((((((((...((((((((((..(((((........)))))............(((((((((.....((((..((.((((((...)))))).)))))))))))))))......((((((((((((((......((.((.(((.........))).))..))......))))))))))))))))))))))))...)))))))))..((((((((((((((((((((....................(((((....((((((..(((.................)))....)))))).((((.(((((((((.......))).........(((((((...................((.((((......)))).))......(((((.(((....((......)).....))).)))))..........))))))).)))))))))).)))))..((((((...................))))))..))))))))((((((((....))))))))....((((((.((....)).))))))...((((((((((..(((.........))).((((.(((......)))))))..........(((((........))))).....))))))))))...)))))))))))).........((((((((((((((((...))))))....(((((((.......)))))))(((((...((((((.((((.....((.(((((.(((((((((((((.((((((.....((((.(.((.....((((((..((..........((((((.((((...(((......................)))...))))))))))...........))...))))))...)).).)))).....)))))).)))).))).))))))((((((.(((...))).))))))))))).))....)))).))))))...)))))((((....((((.....)))))))).(((((((.((...)).)))))))..)))))))))).......((((..(((((.((....)).)))))..))))........))))..)))))))).))))))))))...))))).)))))))))..((((((((((((..(((((((..(((((((((((......)))))).)))))..........((((((((..(((.((((........))))....)))..)))))))).))))))).....(((((((((((.(((((.(.((..(((.((.(((((((.((((((.....(((((..((((((((.(((((((((.(.(.(((...(((........)))....))).).).)).))))))))))))))).........))))).....)))).))...))))))).)).)))..)).).))))).)))))..)))))).((((...((((....)))).))))....(((((..........).)))).....))))))))))))...((((....)))))))))).).))....)))))))......(((((((((..........................))))))).))......)))))))))).))))))))...))..)))))................................)))))).....)).))))))..)).)))))))).)).......................(((((...(((((......))))).....)))))))))))))((((......)))).(((((((((.(((..((((((......))))))....(((((((((..(((((.....(((((((.(.(((..(((((((.((((...........(((....((((.((((((((...(((.(((((.......((((........((((((((.(((((((((....((((((((((((((((.....(((((.((((.((((((((........))))))))..)))).))))).....)))).....))))).....))))))).)))))))))))))))))........))))............))))).))).)))))))).))))....)))(((((............))))).)))).))))))).........((((((.....))))))..((((((((((((((((((..(((((((((..........)))))))))..((((...))))((((.(((((((((((.(((.(((((....((((((.((..(...((((((((((..((((((...((((((((...((((((((((....)))).))))))...))))))))))))......((((((....((((((((......))))))))....))))))((((((..((((.....)))).)))))).((((((.((((((((((...((((....(((...)))......((((((....)))))).................................))))....)))))))))).))))))................((((((((((..((((.((((((.((((((......(((((........))))).....))))))..)))))).))))....((((.((..((.(((((((......))))))).)).)).)))))))))))))))))))))))))).....)..))...))))))....)))))...))).)))).))))))).))))))))))))))))))))))...(((.((((((.(((((.......((((((.....)))))).....)))))..(((((..(((((....)))))))))).(((((...........((((((((((((((((((((((((((((((((((((((((..(((((.((.((((((((((((......(((....)))..((((.((((((((((((((((((...)))))))))))))))))).))))...((((((((......))))))))......)))))))))))).)))))))..((((...))))))))))))))))))))))))))))))))))))))........(((((..(..((((((...(((((((((((.((......)))))(((((....)))))((((((((..........((((((((((((((....(((((((..(((...((((((......(((((((((...((.(((((((((...((....))....)))).))))).)).....(((((((((((((((....)))).)))(((((...(((((((((((((......))))..)))).)))))..)))))..(((((..((..........))..))))))))).)))).))))))))))))))).....((((.((((.(((......(((((((((.......)).)))))))......))).))))))))..............(((.((.((((.....)))).)).)))...)))..))))))).....))))))).....))))).)))))))))).(((((((((((((((((....((((((((((..................(((.(((.(((..(((((((((((((((.((...((((((((((.....((.(((((....((((((.................))))))....))))).))((((((.......))))))((((((((((...((...((((..((((((((...((((((((((...(((.((((..(((((((..(((((((((((((.........)))))(((((.((((((((.........)))))))).(((((((.......((((..........(((((((((..(((((((..........))))))).................)))))))))((((((((((...))))))))))((((((((((((............))))))))))))...(((..((((..(((((((((((.((..((((.............)))).)))))))))))))))))..))).....(((((((((....((((((((((((((......)))((((((((((((.....((..((((.............))))..)).....))))))...))))))....(((((((((.....)))))))))((((.(..(((.(((((((..((((((.((((.(((((.((...((((((........)).))))....)).)))))..)))).))))))....))))))).)))..).))))...(((((((((.(((........))).))))))))).....((((((((.(.............).)))))))).......((((((.....((((.......))))....))))))))))).....)))))))))))))))((((.......))))....(((...........))).......)))).......))))))).)))))..)))))))).)))))))(((..((((...))))..)))....)))))))....))).)))))))...).))))))).)))).))..))))))))))..)))))).))))....)).)))))))))).....(((((.(((((((...........(((((.(((.....))).)))))..(((((......))))).(.((((((((((((...))))).)))).))).)((((.........)))))))))))..)))))...)))))..)))))))))..(((......)))((((((((((..............(((.......))).........((((.((.(((((((((((.((((((((((((((((((((.(((((.....(((((.(((.(((((((((..(((..((.((((((..((.((.(((((((..(((((((.((((((((...((((((....)))))).........(((......))).....(((((.((((((.......(.((((.(((((((....(((((((((((((((((((.....(((...((((((((((.((((((((((.((((((....(.(((((((.(((..(.((.(.(((.((((((((.(((((((.((((((((...((((..(((.((((((((.................(((((((((.............((((((((((((.......(((((((((((((...........)))))))))))))....)))))))))))).........))))..)))))((((...)))).................)))))))).))).)).))...)))))))).))))))).)))))))).))).).)).)..))).))))))).)....)))))).)))))))))).))))))))))...))).....)))))))))))))))))))....))))))))))))...))))))..))))).......)))))))).)))))))..))))))).)).))..)))))).))..)))..))))))))).))).))))).....))))).)))))))))))))))))))).))))))))))).)).))))....))))))))))....(((((.((((((((((((((((((((...........(((((.....))))).((((((.((((((((...................(((((....)))))..((((((((((.((......(((......))).....)).)))))))))))))))))).))))))((((((...((((((((............((((((....((((((....))))))....((((((.((((((((((....(((((((.((((((.....((((((.......((.(.((((....)))).).)))))))).....)))))).)))))))...(((((......(((((((((((.(((((((.....))))))).)))..........))))))))........)))))(((((.(((((((...........)))))))))))).)))))).......)))))))))).....))))))..........))))))))))))))..((((((((((...((....))(((((.((((......)))).))))).)))))))))).((((.(.(((.(((((((((.............((((((.((..........)).))))))............)))))))))...))).)...)))).)))))))).))))...)))))))).))))))))))..)))))...))))))))))......(((..((((...))))..)))..((((((....)))))).)))))))..))))).)))...))).)))..)..))))).)).))))...........)))))..........)))))).))).....))).).)))))))....)))))((((((....(((((.(((((.....(.(((((((((..(((.((((....))))...))).))))))..))).)))))).)))))...))).))).(((((((.((((....((((...)))))))).)))))))((((...((((((...........(((((.......)))))..))))))...))))..........)))))))))))).)))))))))..................)))))).....
Thermodynamic Ensemble Prediction
..((.((((((((.((.(((.......))))).)))))))}}.))....((((((((((...)))){(((((((({(((((((,,{||((((((((((((.....((,.((.(((.((.((((((((((.((((.(((((.((((((((((((((((((((((((((.((((((..((((((((((((((.(((((((((((,.,.{{.({....)).}}.}.).,,)))).)))))}).)))))))))))))).)))).((((((((((.(((((.(((((((....))),,))).)))))..({(,,.....((((((........))))))}))}....(((((..(((((((...(((((((...}))))))..(((((....))))).....((.(((.(((.....))).))).)))))))))..)))))((((..((((((.....)))))).))))..)))}})))))))).)))))))))))))))))))))))))),))..,((({,((((((((((((,,...,.((.(((((((((((((.((((((.{((,,,..||.|||)).........},.)))))).)})))))))..........,})))).)).,{{.||((|{,((((..(((((((...(((((((((.((((((......{.(((....))).}......))))))...(((((,,,,({{,...(((({.........{{{{....(((((((((((....))))))))))).,,.{{{(|,,,....{{{{....,}}}.......,..|,{,,((((.....})),.,||||,.((((((.(((...(((....))).)))))).))}......((((((((((((((......))))))..{{,,{(,,((({(((,,..,((((((,.(((((((...........((((((((((.((((((((..,{{{(,.((((((((((((..........,,,..{((((((....((({....})))....))))))),,.,|,(((((((,.,,(({{{((((((((...(((((((((({.,,,(((((((,....,,}||...,,})},.....((((.((((..(({,((((((......)))).)))))..)))))))).{{{{..,,,,})))))))))))))))))))))..,,..))})}))).)))).})))))))))))).}|,,,,,(((((((((({....))))).)))))},{{{{.{(({{((((.(((((((.........{((({,,{{{{{{{(((((((..((,(((,,,,||}||..}}}}},,.}}}}})}|||{(((((((.,{.{{((((.(((...))).)))),})})))))))}.||}|{{({,({{...(((((...)))))...})),))}((((.((((((((....{((,{{.,,.{(((..((((((((((((((...)))))))....)))))))..))}},.,)}.,,)))),}))).)))).......,.|}}|,,,))}}.,,,.,,,,}|||||},}.)))}},,}},.}}},,,,}}}}}......)))))))..))))}..||}||}.||{|||.....,|||||.,{....},..},|{{{{|.,,))))))))|)))))))).))))).|((((.((((((((.(((.((((((((.,{.((....(((((((((......((((..(((((.((((((..((((((((.......))))))))(((((..,...{{.((((.((.....((((((........,,,,......,,,...)))))).,..)).)))).}}.......)))))............)))..))))))))..)))).....)).)))))))..)).},..))))).))).))))))))))).))))))))...........)))))))...)))))))}||,|||..,}}))}.,}.}||}}{|||,,....))),..}}},.((((.({{{.(((((((({{{({.((({.(.....}.)))}...}}..........|{{(((((((((.,.....,.))))))))).}|}(((((((((...,,..,..,.((((........)))).....{({{((((...{{{{.(,((({(,((({(..(((....))).,)))),.......,,....},...,,,}}.........{{(({....,,)),...,.,|||}},}}}),}}.}}}}}))).))))))))).....|{...,,)})))))))).})......)).)))))))))))).}))}..,,.....})))).....)))),,,,,))}},)))))))))...)))))))..))))..,,,)))})}.,},)))))))))}})))))).......,.....))).))))..)))))......(((((..(....)..))))).))))).)))))..)).,.))..)))).)))))))).{{{...((....}}.},.}}}...((.((((........)))).)),..,|||,,.........((((......))})(((((.(({{((({.......,,{{,,...{(((((((({........(((((((((((....))))).....)))))).....}}))))))}}{({((((..,.,.(((((((..((({((({,(((((..,({{.,.(((((..(((......)))..)))))...,.}))..))))))))).).)))..))))))).}.{,,,,....((((((((((((({{{{(((,,...,,,}}}))}...((((,,..}))).........,,,.(({({(,({{{((((....}}}}.........},|{{,.....{{||,,..(((((((((..{{,{((.....((((((((((........(((((.........)))))...((((((((((((((..(((((......)))))............((((((....))))))..............))))},))).))))))....((((((((..(((((((((((((.,.((((((((((,.{((({........}}))}............(((((((({....,((((.,({.((((((...)))))),).)))))))))))))......{(((((((((((((......({.((.(((.........))).))..))......))))))))))))))))))))))))...)))))))))..(((((((((({{((((((({..{,....,,..........(((({....((((((..((,....,,...........,,}....)))))}.((((.(((((((({.......|||....,..,,||(((((,|{...........,....,|,|||,..}}}.,,,.,}|||.,,.(((((.{((.,,.,,.....,}}|,...))}.))))}...,},.,,,})})))},}))))))))).})))),.((((((....,........,.....)))))).}))))))))((((((((....))))))))....((((((.((....)).))))))...((((((((((..,|,.|,,.....|,{,((((.,{,.....,},.}}}}..,,,,,...{{{{|,,....,,}))),.,...))))))))))...}}}}}}))}}}},{{......(((((((((({{{(((...}}}}}}...{(((((((.......)))))))}{{{{...,{{{{{,{((({{{{{(({((((({((,,,{,{,,{{{,,,{{(({{...,..,.|}||....,((({{{..,...,{|,,...((((((.((({...{{{......................}))...))))))))))..,,....,,,|{{,,|}}}}}...,))}}),,,.....}))))}|||.|,}))|)))))}((((((.(({...})).)))))}||||,.}}..},)),,.}}}}}}...,}}}}||||.,||{{{{.....)))))))),{{{{|||,||...}},)))))))..))))))))))..,.}}}|||{{,{(({{.,{....,}.)}})),,)})},,,.....))))..)))))))).))))))))))...))))).)))))))))...}})),))))}}...........(((((((((((......)))))).)))))......}))))))}}})))}....(((...(((...,.||,.,.}}|,(((,,..,}))))),.,,,,{{{||||{|{}}},,}..}}}}.|}}||}}}|..,)}})}}}{((((...,,,.({,,.((((((((.((((((({{,(.{.(((...(((........)))....))).}.},)}.)))))))))))))))...))....,}.))}},.})))))).)))))|{{({....})))}}})))))))}..(((.(((((((..{(((.{{((((....)))),))))....))..))))).)))..,....,.......,)))))))))...,,,,.{{{{{(((((((.{{{{{.{{{{.((((({.....{,(((((((....,,....................)))))))|}|{,....})))||,((((((((((..(((((..((((((((,..............,((((....{({,...}))}...}}}))}}.|||((((((......)).)))}}}}((.{(((((((((((((.(((((..(((((......}}}}}..{(((((.((((((.(((((((..((({{||{((,,((({,,(({..,{{{{,,{,,||}}}}|||||,|||||||}},,|(({{.{((((.((((((...((..(((..((((.,.((((.......))))...)))))))..)).))))))...))))}......|||}.,{{{{{{{{{{,{{{(((({{{..,,{|{{{{{{{{{{{,,{{,,,,{,{({,(((((((....}}}}}))..,,,}}}))})))}}))))})))))}})})})}}...}}}}})))}}|||||,|||..,}))}..))))))}..}))))}}))))},......,.,..{{{{,,,|{{,{,|,.,,})}})|||{{{{{,,,.||{{{,{{{,.|||,,,,}})},))}}.,}}}},,,,..{{({{{.....)))))}..((((((((((((((((((,.(((((({((,{{,,,,||.}}}}}}}}}..{,,{,{,,{{{(({..{{{{(((((((.{(({((({,..,.{{((((,({,,{,,.{{{{,{{{{{,,|||,{({{,((((((((...((((((((((....)))).))))))...)))))))).}))},.,..{((((({{{.((((((((......)))))))),}}.)))))}(((({{{.((((.....)))).))))))||||||||||(({,{|,,,,...}})),,||}},.,,)),},}||||||...,})))}},..{{{,,,,,,,,.{,,,,......,,,,,..........,}}}}|,}}}}}}}}}}}.,,,}},,........,{(((((((,,,{{{{.{(((((.((((((......(((((........))))).....))))))..)))))},))}}...,}}|},|,..,,.{((((((......))))))}|||{|..,.|||||||||,,|{{|,,,,,}}}}||..,}|.}),,,)))))}...,|||}}...})),)))}.,}}}}}}.,,,)))))))))))))))))))...})))))))}..,,}}..,.,...,,}))))))))))).)),,)))}.))...(((((..(((((....}))))))))).....,........,))))))..{(((((((((((((((((((((((((((((((((..((((,{((.((((((((((((,{{{..,,,,,,,)}}..((((.((((((((((((((((((...)))))))))))))))))).))))...((((((((......))))))))......}))))))))))).)))))))..((((...))))))))))))))))))))))))))))))))))))))))..))))).))...)))))))){(({....},||(((,((......})}}}(((((....))))){{{{{{{{{...,,{.,,((((((((((((((.,..(((((((..(({...((((((......(((((((({...((.(((((((((.,.((....))....)))).))))).)).....(((((((((((((((....}))).)))(((((...(((((((((((((......))))..)))),}))))..}))))..|{{{{.,{{,.........,,..))))))))).)))).)))))))))))))))...,.((((.((((.(({.,,...(((((((((.......)).)))))))...|,.})}.))))}))),|,......|{{,,(({.{{.{{{{.....)))),)),))),,.)))..)))))))..,,.))))))}...,})}))).})}))))}},..,,}}},.}}}))).})}}.)).))}.))))))}.}))})}},.,,,,..,{,({,{{.{{{((.(((((((((....{(((..((((((((({{{{.,,.(((((.{{.(((({{.................}}}}}}.,..))}}},||({(({{.....,.||}}||((({((((((.,.{(...{{((..{(((((((...((((((((((...(((.(({,..(((((((..(((((((((((((.........)))))(((((.{(((({((..,......)))))))}.(((((((..,{{{{((({..........((((((((({,(((((((..........))))))).................)))))))))((((((((((...)))))))))){(((((((((((.,..........))))))))))))||,|||}}||||}.(((((((((((.((..((((.,,........,.)))).))))))))))))),}}}..},,.,,..(((((((((....((((((....,(((......)))|(((((((((((.....{{.,((((...{{....,,..}))),,,}.}...))))))...)))))}..,{(((((((((.....)))))))))||{{,(,,(((.(((((((..((((((.((((.(((((.((,,.((((,,........},.)))).,,.)).)))))..)))).))))))....))))))).|||..|,}}||,,.(((((((((.(((........))).)))))))))....,|||{{||{.{||,..,.......).)}||}}},..|||}}{(((((.,{,,((((.......)))).,..))))))})))))),,.)))))))))))))))((((.......))))....,||,,||,,,,|,.||||.,,.}})))).,,....))))))).}))))..)))))))).))))))),{{..(({{...))))..}}}....||}||}}.,..}}},,))))))...}}}||)))}.}))).}}..}}}}}}}}}}}}))})},})}}|}},....|{(((,..........))))},,{({{({{{{{{..({{((((({(((,,{{,,,,})))))}..,,,{{{{{{{{{{{{{(,,,{((({{{{{{...})))}.{|{|{|||{{({{{.........})))})))))},|}||||,..{((({,(((((.((.((((.(((((((((((((,{{{{{,,........,|||,(({.......}))..{,,,,,.((((.((.(((((((((((.((((((((((((((((((((.(((((.....(((((.(((.(((((((((..(((..((.((((((..((.((.(((((((..(((((((.((((((((,{(((({{{,..,|}}}}}.........(((,.....,,,}}},.{{{{{.((((((.......{.((((.(((((((....(((((((((((((((((((.{...(((...((((((((((.((((((((((.((((((....(.(((((((.(((..(.((.(.(((.((((((((.(((((((.((((((((...(({(..(((.((((((((....,,.,,,.,,,,,((((({((((.....,,,.....{(((((((((((.......(((((((((((((.{,....,,..)))))))))))))....)))))))))))),},......))))..}))))|(((...)))}......,}}}}},,,,,)))))))).))).)).))...)))))))).))))))).)))))))).))).).)).)..))).))))))).)....)))))).)))))))))).))))))))))...))).,...)))))))))))))))))))....))))))))))),...))))))..))))}.,}}}}.)))))))).)))))))..))))))).)).))..)))))).))..)))..))))))))).))).))))).....))))).)))))))))))))))))))).))))))))))).)).)))){|{{{{{.......,|,|}}||(({{{,,.{|,,...,}}})))}}|{({{{{(.{((((.....))))}.(((((({((((((((.{{{{.......,,.}...(((((....)))))..{(((((((({.((....{{((.....,,),,,},..)).}))))))))))))))))).}}))))},,,.....,,{{,,,..(((({.........})))},,|||(((((((.{,,.........).))))))}},.......(((((((.((((((.....((((((.......((.(.((((....)))).).)))))))).....)))))).)))))))....................(((((.(((((((.....))))))).)))))}))))))).)))))))))))))...)))).)).))))),|}},,,,(((..{{{.......,.})),,))}....,}}})),....,}},,..,,,.}}},...}}}}}}...}})))}}}..{{{((((((((((...{{....||{{(((.((((......)))).))))),)))))))))},}}}..,....,|||||,|||}}..}}}}}}}..{{||||.|||||||,,,,,,},||||}}..}}}}.,,{{{||,|||||,{{{{{{{{({{{.{..((((.(({{......))))))))....}}}},,{({{,{{(((({||{({{{||...|}}},||}}}}},}},,}|,..,}|||{{((((....)))))},)))}|||.,...})}..}|,..,,}))))))))).}}}}},,,)),,}}}},},.}}}}}}...}}}}}}...}}},.{,,,.........}))}............((((...}))}.(((((.(((((.....{.((({(((((..(((.((((....))))...))).)))))}..))),)))))).)))))..{{{{{(,,(((,{.........}}},,,,.}})))).....,)),)))})))..))))|,|}..........,{{{,..,..{{|||}}..}})))..,.,,)}}.,|{,,,{{|||.,,|||{|..,,,))))))}|||,,,,.,,....,..)))))).....

Transcripts

ID Sequence Length GC content
GAGCCGAGCUGAGCCUCGCCUAGCUCCGGCAGCCUCAGCUUCAGCACCA… 9933 nt 0.4022
Summary

The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]

Forensic Context

A study in mice demonstrated that HCN1 mRNA expression, a suggested target of the HCN1, was significantly lower in freshwater drowning models and higher in saltwater drowning models compared to controls, showing an inverse correlation with the HCN1 expression and a statistical difference between the two drowning patterns [Yu et al. DOI:10.1016/j.forsciint.2015.06.011].