Basic Information

Symbol
HCN4
RNA class
mRNA
Alias
Hyperpolarization Activated Cyclic Nucleotide Gated Potassium Channel 4 Potassium/Sodium Hyperpolarization-Activated Cyclic Nucleotide-Gated Channel 4 Hyperpolarization Activated Cyclic Nucleotide-Gated Potassium Channel 4 Hyperpolarization Activated Cyclic Nucleotide-Gated Cation Channel 4 BRGDA8 EIG18 SSS2
Location (GRCh38)
Forensic tag(s)
Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_005477.3
Sequence length
6922.0 nt
GC content
0.6173

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-3037.90 kcal/mol
Thermodynamic ensemble
Free energy: -3149.02 kcal/mol
Frequency: 0.0000
Diversity: 1372.60
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((((((..((.(((....)))..))..)))))((.((..((((.((((((((((((((.(((((.(((((((((((.((.((((((....)))))).))(((......))))))))))..)))))))))))))..(((.(((((((.((((.(((......)))(((((((.((((..(.((.((((((((.(((..((((((((((..........(((((..((((((.(((..((....))..((((((((((((.((((((((((.(.....).)))).)))))).)))))...((((((.(((((..((.((......))))..))))).))))))..(((((((..(((((((...))))))))))))))(((...((((.(((((...)))))))))....)))..))))))).(((((((.(((..((.(((((((...))))))))).((((((((.(((.(.(((...(((((((((.((((((((((.((..(((((...((....)).)))))(((.....)))((((((....))))))(((...((((((........))))))..))).)).))))))..)))).......(((.(((((((.........)))))))))))))))))))))).)))).)))))))).((....))(((.((.((((.((((((..((....)).)))))))))).)).))))))...)))))))(((.((((((..(((((.(((((((.(((((...((((..(((((((((((((.((.((((((.((((((.(....(.((.((((((.(......).)))))).)))..).))))))))))))))))))))))(((.((((.(((.((.(((......)))))))))))).)))(((((((((((.(((((((((..((((((.((.((.((((.....((((((((.(((((...((((((..(((((.((((..(((((((((.((.(((((((((((.((((.(((.((((..(((((((..(((...)))..))))....((((.....))))((((.((.((..(((..(((....((((((.((.....))...)))))))))..))).)))).))))...((((((((....))).))))))))..))))..))))))).))))))))))).)).)))...(((((((((((((...(((..((((.....))))..)))..(((((.....)))))..)))))).)))))))))))))))))...))))))))))).(((((..(((((...)))))..))))).))))))))).))))(((((...))))).....(((((.......((((((.......((((((((..(((........))).)).))))))))))))((((.....))))((((........)))))))))..((((((.........)))))))))).)).)).)))))).)))((((((.((....)).))))))(((((((((((...........(((((((((((.((((((((...((((.....)))).)))))))).(((.....)))..))))))..)))))..........)).)))))))))...(((((((((.......((((((..((((((((.((..(((...............)))....)).)))))).))..))))))...)))))))))..((((..(((((..........)))))...))))........(((.(((((...)))))..))))))))).)))..)))))))).........)))))..))))....((.......))(((((((((....................))))).))))........))))).))))).)))))))..)))).)).)))((((((((..((.....))))))))))..)))))).))).)))))..))))))))))..((((((((...((((((.((((.....))))(((((((((((((((((((((......))))).....(((((((((((........)))).((((.((((.((((((.(((((((.(((.((.((((.(.(((((((((.....))))))))).))))).)).))).)))))))(((((((((((..((....((((((((((((((..((((.......))))..((((..........(((((...)))))........))))...((((........)))).))))))))).((((((..(((((((((((.(((((..(((((...(((((.((((......((.......)).....)))).)).)))...(((((((........))))))).))))))))))......(((((..(((.((((((((...........(((((((.(((((((..((((((((((((((((((((((((.(..((...((((((.(((((....(((.....))).))))).)))))).......((((((((.....)).))))))..))..)))))))))))..((((.....)))))))..))))))))......(((((.....)))))...)))..))).))))..)))))))((((......)))).))))).))).)))....))))).(((.....)))...)))))))..))))..)))))))))))....)))))))))))))....((((.(((.((((((.....)))))).))).....)))))))))).)))).))))..(((((((....((((......(((..((.....)))))......))))....)))))))(((.((........))))).........))))))).....)).)))))))))).))))..))))))))))))))..((((....(((((...)))))...)))))))))))).))).)).)..))))...)))))))..(((((.(.....).)))))(((....))).)))).))))))).))).....(((((.....(((((.((((.(((((.(((((..(((((((((.......((((...(((((...)))))..))))....((((((((.(((....)))..)))))).))....(((((..((((...(((((..((.((.((((........))))))))((((((((((...((((....))))((((............(((((((..((.(((((((..(((((.(..(((((.(((((((((((((((.(((((((((((((..(((((((...((((..((((((.((.((((((((((..(((...((((((..(((((....)))))(((((...(((..((..((......))))..)))....)))))((((.(((((.((((.((.(((((((((((((....((((..(((((((((..((((((((.((((((((((((..............((((((((.((((((((((((((...))))).)).)))))))..................((((.......)))).))))))))..)))))).))))))..)))))))).))......)))))))..).)))....))))))..((((((...((((.(((((.((....)).))))).((....))..)))).))))))(((((...)))))(((((((((.((((....))))......((.((((.((.((((.((((((......(((((((.....(((.((((......))))))).((.(((...))).))..(((((((((.(((((..((((((((.....(((((((((((....(((((((((...............)))))).)))........))))))..((((((((((.((((((..((..((((((((...)).)))))))))))).....)).))).((((((..........))))))......((((((((((((((((.....))))).))))).))))))(((((((((.(((((.((((((((....))))))((((.(((((...((((.((((((((((((((((.((((.((((((((((((((((......(((........))).....)))))))...)))))).)))(((.((((....)))))))......)))))))))).))...).))))...))).)))))))))...)))).)))))))..)))))).))).....)))))))(((.(((.(((((((((((((..........(((((((((((((((((.....(((((.(((((.(((.((.......))))).)))))..............))))).......................................((((((.....(((((((((.....(....).....))))))).)).....))))))........)))))))))))))))))))))))))))..))).))).)))..........(((.......)))....)))))....)))))))))))))))))))))).((((....))))))))))).(((((.(........).))))).....(((..(((((((.(........).)))))))..)))(.((((((..((((....))))..)))))).))))))).)))).)).)))).))....)))))))))(((((.(((((((((((((..((((((...)))))).)).)))))))).((((.((((((((.(((.(((((((((..(((((((((....)))))))))...(((((((((((...(((((.((..((((....))))....)).))))).....)))))))))))..)))))))))))).))).......))))).))))....))))))))(((.((((((((...(((((((....(((...((((.(((..(((..(((((.(((..(((((((.(((........))).)))))))))).)))))..))))))))))((((((((((((.((((...((((((.(((..(((((.((..((((((..((((((((.(((.....))).))(((((((.((((((..((......(((((((((((((((((.((((((..(((((.......)))))....(((((((..(((........)))))))))).((((.((((....)))).))))..............((((((...(((((((.((....((((((((.((((.(((((...(((((((.(((((.((.(..((((..(((((((((((.(((((.((((((((.(((((((((((((.((.((((...........((((((((((.((((..(((..(((.(((((((.((..(((((.((.(...((((((((...(((((((.........))))))).)))))))).).)).)))))..))))))))).)))..)))..)))).)))))))))))))).)).))))))).)))))).)))))))).))))).))))))))))).....))))..).)).))))).)))))))...))))).))))))))))))...((.(.(((((((..((((.((((..........(((((............((((((((.((.......)).))))))))..........))))))))).))))..))))))).).))......((((....)))).)).)))))))....))))))....)))))).)))))).((.(((........))).))..))))))))).))......))..)))))).))))))).))))))..)))))))).)))))....))).))))))...)))).).........))))))))))).)))...)))))))....))).))))).)))))))))).))..)))).))))).))))))))))....)))..))))).))))).)).))))))..))))...).)))).))..))))))))..))))).)))......)))))))))))).........((((((.......)))))).....)))))..))))))..)))).))).)).....(((((......)))))....((((....))))(((.(((.......(((.((((((....)))))))))....))).))).((((.((((((((((..(((.((((.((.(((((.((((...............))))..)))))))))))....(((((....)))))......)))..))))....))))))))))))))))))))).................)))))))))))))))..)))).)))))..(((((((((((.((((((...((((((((...(((((((((.(((((((((........)).))))))).)))(((((.((((((((....(((((..((...))..)))))......))))))))..)))))....((((((......)))))).....)))))).....)))))....)))...))))))..)))).))))))))))))))))))))).))))).))))..)))))...((((.((((..(((((...((((..(((.....)))..))))..................(((((((.......(.((((.((((..((.((......))..))..)))).))))))))))))))))).)))))))))))))....))).)).....))))).)))))).)).........((((....((((......))))..))))...((((((....)))))).....)))))).
Thermodynamic Ensemble Prediction
(((((((((((,.{,.({({...,,)}.}}..)})))|||{,..((({.{(((((((({(({(((((((.(((((((((((.((.((((((....)))))).))(((......))))))))))..))))))))))))).,(((.(((((((.((((,(((...,,,|||(((((((.((((..(.((.((((((((.{((..((((((((((.........|(((((..((((((.(((..((....))..((((((((((((.((((((((((.(.....).))))}}))))).)))))...((((((.(((((..{(.({{{....))}},,))))).)))))),,(((((((..{((((((...))))))}))))))){{|.,.((((.(((((...)))))))))....})},.))))))).(((((((.,{,..((.(((((((...))))))))).((((((((,(((.(,(((...(((((((((.((((((((((.((..(((((...{{..,,}}.))))|(((,..,,|}|((((({....}))))|(((...((((((........))))))..})).)),))))))..)))),,.....||,{(((((((.,.....,.)))))))))))))))))))))).))))))))))))).,{....}|(((.((.((({,((((((..((....)).)))))))))).)).))))}}...)))))))(((.((((((..((((,,(((((((.((((({,.((((..(((((((((((((.((.(((((,,((((((.,....{.{(.((((((.,,.....,.)))))).))}..,.))))))))))))))))))))))(((.((((.(((.({{(((......)))))))))))).)))(((((((((((.((((((.((((((...)))))).{((((,.,.{((((((((.(((((,{,((((((,,(((((.((((..(((((((((.((.(((((((((((.((((.(((.(({({{(((((((..(((...)))..)))).,}.||||.}}..}|||({{,,||||.{{((({.((({(...||{||,{|,,,},}},|.||.)))}},..||||}}||||||,.{{((((((((....)))}}))))})).,}))),.))))))).))))))))))).)).)))...(((((((((((((...(((..((((.....))))..))}..(((((.....))))).})))))).)))))))))))))))))...)))))))))))}(((((..(((((...)))))..))))).))))))))).))))|{{||...))})}...||||||...........{||||..}},{(((((((..({{.....,..))).)),}}}}}|(..((((((((((((((..(((...{(({...)))}..(((((((.((.....({{..,.,.((,.,((.(((((((....))..))))),))...)),}}..})),.)))))))))..(((((({....}))).))){.((((((((...{(((....,)}}}.)))))))),,{,.....}},)))...))))))))))))))..}}|||,,...|||}..,.(((((((((.......((((((,,({((((((.((..(((...............)))....)).)))))).)),.))))))..,))))))))))}}}}))}}}......,,,,,..{{{|,.....})},..}}..(((.(((((...)))))..))))))))).)))..)))))))).........)))))..))))....{{.......}}(((((((((.......,,.....,,....)))))}}))).....,,.))))).))))).)))))))..)))).)).)))((((((((..((.....))))))))))..)))))).))).)))))..))))))))))..{(((((((...((((((.((((.....))))(((((((((((((((((((((......))))).....(((((((((((........)))).((((.((((.((((((.(((((((.(((.((.((((.(.(((((((((.....))))))))).))))).)).))).)))))))(((((((((((..({..,.((((((((((((((..((((.......))))..,{{{,.,{......{(({{...}}|||,,......))}}...||{|,.,,....))}}.))))))))).((((((..(((((((((((.(((({.,(((({...(((((.((((...,..{{.......}).,...)))).)).)))...(((((((........))))))).})))))))))..,,,.(((((.,(((.((((((((...........(((((((.(((((((..(((((((((((,((((((((((((.{{.{{...((((((.((((,.,,.(((.....))),))))).))))))...,,..((((((({.....}).))))))..)),.}))))))))}|,,({{{..,,,)}}},})},)))))))).....|(((((.....))))).,.)))..)))}})))..)))))))((((......)))).))))).))).)))....))))),{((.....))}.,,)))))))..))))..)))))))))))...,}})))))))))))....({((.(((.((((((.....)))))).))),,...,,}})))))).)))).)))){,(((((((....((((,.....(((...(..,...,}}}...,..))))....))))))).|{.{,.....,,,))))),........))))))).....)).)))))))))).))))..)))))))))))))}..((((....(((((...)))))...)))))))))))).))).)).)..))))...))))))}..{{(({,|.....}.)))))(({....))).)))).))))))).))),,...,{{({.{{{.(((((.((((.(((((.(((((..(((((((((.......((((..,({{{(,,,|}|||,,|}||....{(((((((.(((....)))..)))))).)}....||{{|,,{||{.,,||{{{..{(.((.((((........)))))))}((((((((((...((((....))))(((({(((({......,,,,{(({{((.(((((((,.(((((.,..((({(.(((((((((((({((((((((((((((((..(((((((...((((..((((((.((.(((((((((({,({,...((((({..(((((....)))))(((((...(((..(,.{((......}}}}..)))....)))))((((.{((((.((((.((.(((((((((((({....{{{{,.((((((({,,.((((((((.((((((((((((..............((((((((.((((((((((((((...))))).)).)))))))..................,(((....,..,,,,.))))))))..))))))}})))))..)))))))).).......)))))))....)))....|}}}}}{.((((,(.{{((((((,((({((,...||{||||..,,..}}))}.||||{|||||(((((({,.,,,|{(,((((({{.(((,..,}))))}}},,}}}}}}}}}(({,,,,,||,|||}}}}..{((((((.....(((.((((......))))))).((.(((...))).}}.,(((((((((.(((((..((((((((.....(((((((((((....(((((((((...............))))))},))........)))))}..{(((((({{{.((({{,..{(..((((((((...)).))))))}}||}|,,..|}}.}}}.((((((..........)))))).,....(((((({(((((((((.....))))).))))).))))))(({((((((.(((((.((((((((....))))))({(({((((({..,||,}||,|||||||((((((.((((.{{((((((((((((((......(((.....}}},}}.....)))))},..,))))))}}))|((.((((....)))))))......)))))))))).||{{{|.|}},.,})))})}}}|||},..,)),}.)))))))..)))))).})).....))))))}(((.(((.(((((((((((((,,{,.,...,((((((((((((((({{...,.(({{{.{((((.{((.({,......)}})}.)))))...,,....,,...,,},}......,,,,{,,.......,,...,,,{,,.,,.....,||,||}}...,{||.,,|{}}}}}|}}....,|||,,},|}|,,},....,}}},,.,}}....)))))))))))))))))))))))))))..))).))).)))..........(((.......)))...,)))))....))))))))))))))))))))))}((({....))))))))))}.(((((,(,{...,,,).)))))....,{((..{{(((({{(,.{{{{..,.,})))),..,,}||}|}},,.}}}}||,{{,.....))))))))),))))},)))}})})),).)|||,,},,}|||||((({,{(((((((((((((,.((((((...)))))).||,}}||}}||,({{{.,{{|||((.{((.(|(((((({..{{(((((((,,,{||}}}}}},...|{{(((({((|,,.(((((.((..((((....))))....)).))))).....})))))))))}}.)))))))))))).}))....,,,)}))),}))),...)}}))))}(((.((((((((...(((((((....(((...((((.(({.,(((..(((((.(((..(((((((.(((........))).)))))))))).)))))..))))))))))((((((((((({.((((...((((((.(((..(((((.((,.((((((..((((((((,{((.....)))))|(((((((.((((((..{(......(((((((((((((((((.((((({..(((({,,....,)))))....(((((({,({{(........)))))))))).((((.((((....)))).))))..............((((((..{(((((((.((....(((((({((((((.(((((.,.(((((((.(((((,({.(..((((..(((((((((((.(((((.((((((((.(((((((((((((.((.(((,{{......,}{((((((((((.((((..(((..(((.((((((({((..(((((.((.{...((((((((...(((((((........,))))))).)))))))).}.)).)))))}}))))))))).)))..)))..)))).)))))))))))))).)).)))))))))))))).)))))))).))))).))))))))))).....))))..),)).}}))).)))))))...))))).))))))}))))}...|{.{.(((((((..((((.((((,........,(((((............((((((((.((.......)).))))))))..........))))))))).))))..))))))).)})},.,...{(((....))),.)).))))))),}..))))))....)))))).)))))),,{.,,,....,,..,,}.....})))))))).))......)}..)))))).))))))).))))))..))))))))})))))....))).))))))...)))).}.........))))))))))).)))...)))))))....))).))))).)))))))))).))..)))).))))).))))))))))....)))},,}))).))))).)).))))))..))))...).)))).))..)))))))}.,)))),.))),.....)))))))))))).,{{{{((.((((((.......)))))))).}})))))..,))))).,||||.}}}.||,,,..(((((......}}}}),,,.{(((....)))){{{,(({...,,,.(((.((((((....)))))))))....))).})}.{{{|.{{||||||{{..{{{.(((,{((.(((((.((((...............))))..))))))))))),,..|||||..,,))))}......}})..})))....))))))))))))))).))))).................))))))))))}))))..)))),))))}..(((((((((((.((((((..{(({(((((...(((((((((.(((((((((........)).))))))).)))(((((.(((((((({(,,(({{{..{{...}),.))}}}.}}...))))))))..)))))....((((((......)))))).....))))))..,..)))))}},..})...))))))..)))).))))))))))))))))))))).))))).))))..))))).}}|{((.({{(,.{((((...((((..(((.....)))..))))..................{((((({.......|.((((.((((..((,{(......)),,})..)))).)))),})))))}))))}.)))}}))))))},.,,.},,.}},....))))}.}))}...}}.........,{{|....((((......))))..}}}}...{(({{{....)))}},.....)))))).

Transcripts

ID Sequence Length GC content
GCUGGAGCCGCUCCUAUGGCAACCCGCGAGCUGCGGCGGCUUCAUGAAU… 6922 nt 0.6173
Summary

This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]

Forensic Context

A study in mice demonstrated that the HCN4 mRNA was downregulated in cardiac mesenchymal stem cells following HDAC11 overexpression [Zhang et al. DOI:10.3390/biom15050662]. In a separate mouse model of myotonic dystrophy, the HCN4 mRNA was identified in a complete expression change list, with its downregulation being compatible with findings from another mouse model of the disease [Lee et al. DOI:10.1093/hmg/ddac108].