| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGUUCACAGCUGCCCUGUUGCAGGGAGGCGGUGGCCCUUCUGUUGCUAG… | 1262 nt | 0.5658 |
This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]
A study in humans developed a multiplex mRNA assay for organ tissue identification, where the AMBP was validated as a specific mRNA marker for liver tissue identification [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7]. In a separate proteomic study, the AMBP was identified as a protein biomarker for urine identification when detected in the absence of hemoglobin, using mass spectrometry on forensic trace samples [Van Steendam et al. DOI:10.1007/s00414-012-0747-x]. The biomarker the AMBP is identified as a protein marker found in urine for body fluid identification [Alex et al. DOI:10.1016/j.scijus.2025.101320].