Basic Information

Symbol
AMBP
RNA class
mRNA
Alias
Alpha-1-Microglobulin/Bikunin Precursor HCP Protein HC IATIL ITILC EDC1 HI30 ITIL UTI Complex-Forming Glycoprotein Heterogeneous In Charge Inter-Alpha-Trypsin Inhibitor Light Chain Growth-Inhibiting Protein 19 Uronic-Acid-Rich Protein Protein AMBP Trypstatin Uristatin Bikunin ITI A1M
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_001633.4
Sequence length
1262.0 nt
GC content
0.5658

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-486.20 kcal/mol
Thermodynamic ensemble
Free energy: -509.32 kcal/mol
Frequency: 0.0000
Diversity: 333.10
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((.(((((((((.(((((((((((((((.(((((((((((((((.((((((.(((.((((......))..((((..((((((((.(((.((((((.((.((((((((((((((........)))))((((((((((((((.((((.......))))...)))))))............)).))))).................((((.((((((((((((((........)))))...)))).((((.((.(((((.....)).))).)).)))).........(((((....)))))((((((((.((((((((.(((((.(.((.((.......)).(((((.(((....((((((((......))))))))...))).)))))....(((((((((((((((....)).))))).....(((....))).......(((((....)))))((((....)))).((.((((((((.((((.((.(((((...........((((((((.(((((((...(((((((..((...))....(((.((((.(((.((((((.(((((.((((.((....(((((((((.(((((((((..(((....((.((((((.((((..(((..(((((.(((....))).)))))))).)))).))))))))....)))(.(((((.(((...((....))....)))))))).)...(((((..((..........))..)))))))))))))).)..))))))))....))..)).)).)))))..)))))))))..)))).)))...(((((.(((......))))))))........)))))))...))))))).(((.((.....)))))...)))))))))).))).)).))))...)).)))))).))......))))))))..))))))))...)))))))).)).....))))))))))))))))))))))....))))))))))...))).))))).)))..))))((((.((((((((((((((((.((.((..(((((((.((((((((...........)))))((((.......))))((((......)))))))))))))).....)).)).))))).....)))))))))))...)))).)).)))))))))))))..))))))..))))).))))).........))))))))))))))))(((.((....)).))).................))).)))).......
Thermodynamic Ensemble Prediction
,(((.{{,((((((((((((((((((((((.(((((((((((((((.((((((.(((.{(((......)),.{(((..((((((((.(((.((((((.({{((((((((({((((........))))}((((((((({((((.(((,{(({...,,))}}.))))))).,.......}}.}).))))).................((((.(((((((,,{((((.,,....,}}}}}.,,||}|.((((,({.(((((.....)).))).)).)))).,}.,..,.(((((....)))))((((((((.((((((((.(((((.(.((.(((.({,..{{((((.({,{(......}},((((((({(((..({(((..(((((((.,......{{{,,((((((((....}},)})))}....{((,.,{{{.......|||||||{{,,,,,|(({{....}}}},||.|||||,|}}}|||,}||||{{.....,}.....((((((((.,((((((...(((((((,,{,..,|,....(((.((((.(((.((((((.((((,.{{{|,||{,,{(((((({{..((((((((({.,,,.}}}||,((((({.((((..(({.{(((((.(((....))).)))))))).)))).})))))}|,,..|||(,{((((,(({...{({.,.,|.,,,}},))))).}.,,,((((..{{..........))..)))))))))}}))),)..)))}}}}},}},,,..,)))).})))),,)))))))))..)))).))),,.(((((.(((......)))))))).,......}))))))...))))))}.{{(.{{|...})))))...)))))))))))))))..)))..})..)))).))))))}.}}.)))))))))).))))))))...)))))))).)))....))))))))))))))))))))))....))))))))))...))).))))).)))..)))|((((.((((((((((((((((.{((((..,,})}|,,((((((((,.{,{{,.....||||((((.......))))(({{......))})}})).))))))),..}}.,,.))))).....)))))))))))...)))),,}.)))))))))))))..))))))..))))).)))))..,,...,.))))))))))))))))|{{.||,...}}|||,................,))).,}},.......

Transcripts

ID Sequence Length GC content
AGUUCACAGCUGCCCUGUUGCAGGGAGGCGGUGGCCCUUCUGUUGCUAG… 1262 nt 0.5658
Summary

This gene encodes a complex glycoprotein secreted in plasma. The precursor is proteolytically processed into distinct functioning proteins: alpha-1-microglobulin, which belongs to the superfamily of lipocalin transport proteins and may play a role in the regulation of inflammatory processes, and bikunin, which is a urinary trypsin inhibitor belonging to the superfamily of Kunitz-type protease inhibitors and plays an important role in many physiological and pathological processes. This gene is located on chromosome 9 in a cluster of lipocalin genes. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans developed a multiplex mRNA assay for organ tissue identification, where the AMBP was validated as a specific mRNA marker for liver tissue identification [Lindenbergh et al. DOI:10.1007/s00414-013-0895-7]. In a separate proteomic study, the AMBP was identified as a protein biomarker for urine identification when detected in the absence of hemoglobin, using mass spectrometry on forensic trace samples [Van Steendam et al. DOI:10.1007/s00414-012-0747-x]. The biomarker the AMBP is identified as a protein marker found in urine for body fluid identification [Alex et al. DOI:10.1016/j.scijus.2025.101320].