| ID | Sequence | Length | GC content |
|---|---|---|---|
| CACAAUUGACAGCCUCAAGGUUCCUGGCUUUUUGAACCACCACAGACAU… | 577 nt | 0.6846 |
This gene encodes a hypothalamic neuropeptide precursor protein that gives rise to two mature neuropeptides, orexin A and orexin B, by proteolytic processing. Orexin A and orexin B, which bind to orphan G-protein coupled receptors HCRTR1 and HCRTR2, function in the regulation of sleep and arousal. This neuropeptide arrangement may also play a role in feeding behavior, metabolism, and homeostasis. [provided by RefSeq, Jan 2010]
A study in rats demonstrated that acute carbon dioxide poisoning induces region-specific mRNA expression changes, with hypocretin (Hcrt) mRNA levels in the frontal cortex showing no significant differences between any experimental CO2 exposure groups and controls [Sato et al. DOI:10.1016/J.Legalmed.2015.07.014].