Basic Information

Symbol
HERC5
RNA class
mRNA
Alias
HECT And RLD Domain Containing E3 Ubiquitin Protein Ligase 5 CEB1 HECT Domain And RCC1-Like Domain-Containing Protein 5 E3 ISG15--Protein Ligase HERC5 Cyclin-E-Binding Protein 1 Hect Domain And RLD 5 CEBP1 Probable E3 Ubiquitin-Protein Ligase HERC5 EC 2.3.2.- EC 6.3.2
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis

MANE select

Transcript ID
NM_016323.4
Sequence length
3511.0 nt
GC content
0.4412

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1055.90 kcal/mol
Thermodynamic ensemble
Free energy: -1128.12 kcal/mol
Frequency: 0.0000
Diversity: 969.59
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((....)))))..(((((((((.(((...((((((.((..((.((((((((((((((.((((.(((((...))).))..))))))...((((((((.(((((((...........))))..))).))))))))(((((...)))).)..)))))))...((((((.((..((((((((......((((((((....)))))...)))))))))))))...)))))).(((((((((((....((((((.(((((((((..(((((((..((...((((((.(.((((((((.((((((((.((......)).))))...)))).)))))))).).))))))...))..))))))))))..(((((((.(((...((.(((((((.....))))))))).))).)))))))........................((((((......)).))))....)))))))))))).(((((((......(((((((((((....))))))))...)))......)))))))..((((....((((((((...(((((..........)))))..))))))))..))))((((.(((((((.((.(((......))).))))))))).)))).))))))))))).))))).)).)).))))))))).)))))..))))(((((((.......(((((........))))).((.....)).(.(((.(((((.(.(((((.(((((((.((.((((...((((...(((...((((.((((((.......(((((((.........))))))).......)))))).))))((((((((((((((((.(..((((((((.....(((.......(((((((((....))))..)))))....((((.(((.((...)).))))))))))....))))))).)..).))))))))))))).))).(((((.(((...((((((....((((......))))..)))))).))))))))))).)))).)))).)).)))..))))....(((((((((((((((((((((.....))))).(((...(((((((..(((.....(((((((((.........)))))))))......((((...(((........)))..)))).((((((((((...))))...))))))((((((...........))))))...)))....))))))))))(((((....))))).((((((.(((.........))).))))))..............)))))))))).))))))..((((....))))..))))).).)))))))).)((((((..(((.((.((((((((..........(((......)))....((((..(((((((.....(((((((((((((((((((..((((((((((((((........))))))))((((((((((.(((((((((((((....))))).))))).(((((((((((((.((((....((.....((((((((((..(((.((..........(((((((((..((((.((((......(((((...((((((((((((..((((((((((((((......))).(((((((((...((((.((...(((((((((((.....)))))(((((....)))))..........((((((((..((.((..(.(((((((((....(((((((...(((((........)))))...)))).))).....))...))))))))..)).))..))))))))...))))))..)).))))..)))))).))).((((((((((((.(((......)))...)))))).((((.(((((.((.(.((((.(((((....((((((..........))))))....(((((...))))).....))))))))).).))))))).))))(((((.(((..((((((((((...(((((((.((((((..(((((..((............))..))))).....)))))).))))))).))))).......)))))..........))).)))))..))).)))((((((.......))))))........)))))))..)))).))).)).)).)).)))))))).....))))..).)))..))))))))).)).))))))))...)))))....))....))))..)))))))))))))...((((((...((...(((((((((.......((((((.((((((((((((((.(((((((((......((((((..((((((((..(((((((.((((.....)).)).)))(((((((((.(((.(((....))).)))((((((......))))))((((((((..(.((((..(((.....(.(((((......))))).)((((((((....))))))))(((((((.....))))...)))...)))..))))..)..)))..)))))((((((((.(((((..((((((((...))))))))....)))))..(((((..((((.((......))))))))))).))))))))..))))))))).((((........)))).))))..))))))))..))))))....))))).....(((...(((((((((....(..((........((((....))))))..)....)))))..))))....)))..((((((...))))))..(((.......))).((((((..((((((.....)).))))..))))))..(((((.(.(((........(((((.(......))))))..........))).).)))))........((((((((((((((..........(((((((((.....(((((.....))))))).))))))).........)))))).))))))))..(((.(((.(..((.(((((....))))).))..).))).))).................((((((.....))))))((((..(((((..((((((.....((((.......)))).....)).))))..)).)))..))))....)))).))))))).))))..(((((((......))))))).)))))))))......)))))).)))..))...))))))((((((((..(((.((..((.((((((((((.((.((...((((....))))...)).))(((((((........))))))).....)))))))))).)))).)))..).)))))))............((((((((((......))))))))))...)))...)))))))))).)))))))))))))))))......)))))))).(((((..(((..((.(((....))).))....)))..))))).)))))))..))))....)))))))))).)))....)))))).)))))))(((((((...............)))))))...
Thermodynamic Ensemble Prediction
.(((((....))))){{(((((((((.(((...((((((.((..((.(((((((((((((,{((((..,((({..,,,.,}}}))))))},.((((((((.(((((((...........))))}.,)).)))))))){((((...)))).}..)))))))...((((((.({..(((((((({...,.,,{(((((....)))))..,}})))))))))}}..,)))))).(((((((((({....(((((,{(((((((((..(((((((..((...((((((.(,{(((((((.((((((((,((......),.)))).)})))).)))))))),}.))))))...))..)))))))))),,(((((((.(((...((.(((((((.....))))))))).))).)))))))....,...........{{......{{((,,......))})}))....}))))))))))).(((((((.,..,,{{{((((((((....))))))))...,))......)))))))..,{{{....((((((((...,((((.........,))}},..))))))))..,}))|(((.((((((,{((.(((......))).))))))))).))),.})))))))))).))))).)).)).))))))))).)))))..))},{((((((.......{{{{{,,,,....))))).{{.,{..||,||{((.(((((,(,(((({.{{(((((.{{,{{(({{{{{{(..{(((,..,{{{,((((({..,((({(((((,,...,,,..}))))))))}},,,.}})))),))),((((((((((((((((.(.,,((((((({{,....|}}|....(((((((({....})))..))))).,,,((((.(((.{{...}}.)))))}),,,....))))))).,..).))))))))))))).))).{((((.(((...((((((,...{(((......)))),,)))))).)))))))))))})))).)))}.}}}))),.,}},....((((((((((((((({,{((({,...},}|}.||{,,,(({{{||..|||}.,,,(((((((((.........)))))))))...,,.((((...{{(,,,.....)))..)))).||{{{|||({{{{||||,..}}}}},((((((........,..))))))...,,,..{{{|,,...||}||{,,....}}}}},|}}}})),,}}}|.|||,..,},}|{|,......,...,,,..}))))))))),,))))).,((((....)))).,})))}.}.))))))}).,{(((((..(((.((.((((((((..........(((......)))....((((..(((((((.,...{((((((((((((((((((..((((((((((((((........))))))))((((((((((.((({({((({{{{....}}}}}}}}|||.(((((((((((((.((((....((...,,({{((({(((...,,.,|.,,,},,,,,(((((((((..{(((.((((......(((((...{{({{(((({{(,.(((((((((((....{{(({{{{,,{((({{((..{((,,..,{.,{{{{|{{{{,,|||.||||||||(((,,,.}||||{(((({{{,,({{(((((,|{|,{{,.(.(((((((,,..,,|{||{((,|,(((((.....,..}))}}.,.}}}}.}}}...,,}}...}})})))}..}|.}|,.}}}|}||}.,,,{{{.{{{{{......))))).))}}..||}}|}{{{{||,|||...,..})),,,))))))}|,,,,{{({,,{{.{.{{({.{{({{....((((((.....,....}))))).,,,,,,||||...}}||,.,.})}}}}}}}.}.)))}}}}.}}}}||||},,||.)))}{{(((((...(((((((.((((((..(((((..((............))..))))).....)))))).))))))).))))))}.....||{{{,..............,....,}})))}.||||||.......))))),,,,,....)))))))..)))).))}.)).)).}},,))))))).....))))..)},))..))))))))).,..,||||||}...,}))),,,.))....))))..)))))))))))))...{{{{{{...{{...{((((((((.......(((({{{((({((((((((((.{{{(((((({.,.{,,{{{,({{{{((,,,,}}||||.,...||{|||||}}|||{{{{{{{((((({{{,,.(((,,..|{{{{{|((((,({|||||||||||{{{{((({,||,|{{{.{,{{...|,|||{||||||......{{((((,,......}})))),)))}))||,.,}}||)))}..}}}}|||}},..,|||..{{{|}|.,|||||((((((((.(((((..((((((((...))))))))....)))))..{,{{{..((({{((......))))))}}}},.))))))))..,}})}}}}},{,,|,},,,..,}|||||},},,)}})}}||{.|||,,,}}}.))),,..,,,(((,{.(((((((((....,..,.........((((....)))),},,,....)))))..))))....,,...((((((...))))))..{{{...,,,,}}},{{{{({..{,||||||,.,})}))}|..}}}}}}.|(((((.(.(((,,,.....{{(((.{......}))))).,...,,..,))).}.))))},...,,..(((((((({(((((....,...|.{((((({{{,....{((((.....)))))},}))))))).,..,....))))))}})))))))..(((.(((.(..((.(((((....))))).))..).))).)))..............|{{((((((.....))))))||{||||||||..{(((({.....{{{,.......},,}..,..})}}}}},,))}}}}..}))}}}}.}}},.))))))).)))}..(((((((......))))))).)))))))))......)))))).))),.}|..,}}}}}}((((((((..(((.((..{(.((((((((((,({{(({..((({....}}}}...}.})}|((((((........))))))}.....}))))))))),))}).)))..),}))))))......,},,,,((((((((((......)))))))))).,.)))...)))))))))).))))))))))))))))}.....|)))))))}.(((((..(((..{(,(({....}})})},.,,)))..))))).)))))))..))))...,)))))))))).)))....)))))}.)))))}}{(((({{.............,,}}},,,,...

Transcripts

ID Sequence Length GC content
AGUAGCUGAGGCUGCGGUUCCCCGACGCCACGCAGCUGCGCGCAGCUGG… 3511 nt 0.4412
Summary

This gene is a member of the HERC family of ubiquitin ligases and encodes a protein with a HECT domain and five RCC1 repeats. Pro-inflammatory cytokines upregulate expression of this gene in endothelial cells. The protein localizes to the cytoplasm and perinuclear region and functions as an interferon-induced E3 protein ligase that mediates ISGylation of protein targets. The protein also acts as a modulator of the antiviral immune response. The gene lies in a cluster of HERC family genes on chromosome 4. [provided by RefSeq, Aug 2021]

Forensic Context

A study in human blood samples identified the HERC5 as one of 19 center genes commonly differentially expressed across early-stage, middle-stage, and control groups following burn injury, indicating its association with burn injury progression [Wu et al. DOI:10.007/s10753-018-0829-0].