| ID | Sequence | Length | GC content |
|---|---|---|---|
| AAUAAGUGGUGGUUACUCAGCACUUUUAGAUGCUGUUUAUAAUAGAUGA… | 3865 nt | 0.3656 | |
| AGUGCACAGUGCUGCCUCGUCUGAGGGGACAGGAGGAUCACCCUCUUCG… | 3946 nt | 0.3938 | |
| AGUGCACAGUGCUGCCUCGUCUGAGGGGACAGGAGGAUCACCCUCUUCG… | 3819 nt | 0.3941 |
This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011] CIViC Summary for HIF1A Gene
A study in human blood, saliva, and semen stains demonstrated that the HIF1A mRNA, a hypoxia-sensitive marker, shows a quadratic or cubic decrease in expression over four weeks at room temperature and can be used in predictive models for stain age estimation with a mean absolute deviation of ±2.1 to ±5.0 days [Fisal Asaghiar; Graham A Williams DOI:10.1016/j.scijus.2020.09.001]. In human forensic autopsy tissues, the HIF1A mRNA degraded gradually postmortem at a rate parallel to GAPDH, with its relative quantification (HIF1A/GAPDH) remaining largely stable for up to 48 hours in brain, kidney, and lung tissues, though a deviation was noted in the myocardium [Zhao, Dong; Zhu, Bao-Li; Ishikawa, Takaki; Quan, Li; Li, Dong-Ri; Maeda, Hitoshi DOI:10.1016/j.legalmed.2005.09.001]. A study in rats demonstrated that the HIF1A is a dominant regulator of cellular reactions to hypoxic stimulation, accumulating under hypoxia by blocking ubiquitination and degradation, though not through transcriptional regulation at the mRNA level [Zhao et al. DOI:10.1016/J.Forsciint.2015.08.007]. In mice, the HIF1A is established as a protein marker for the postmortem diagnosis of asphyxia [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].