Basic Information

Symbol
HIF1A
RNA class
mRNA
Alias
Hypoxia Inducible Factor 1 Subunit Alpha BHLHe78 PASD8 MOP1 Class E Basic Helix-Loop-Helix Protein 78 PAS Domain-Containing Protein 8 Member Of PAS Protein 1 HIF-1alpha HIF1 Hypoxia Inducible Factor 1, Alpha Subunit (Basic Helix-Loop-Helix Transcription Factor) Basic-Helix-Loop-Helix-PAS Protein MOP1 Hypoxia-Inducible Factor 1-Alpha HIF-1-Alpha Hypoxia Inducible Factor 1 Alpha Subunit Hypoxia-Inducible Factor1alpha Member Of PAS Superfamily 1 ARNT Interacting Protein ARNT-Interacting Protein HIF1-ALPHA HIF1-Alpha BHLHE78 HIF-1A
Location (GRCh38)
Forensic tag(s)
Time since deposition estimation Postmortem interval inference Cause of death analysis

MANE select

Transcript ID
NM_001530.4
Sequence length
3946.0 nt
GC content
0.3938

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-960.80 kcal/mol
Thermodynamic ensemble
Free energy: -1039.34 kcal/mol
Frequency: 0.0000
Diversity: 1019.16
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((.((((((((((((..(.((((((.(((((((((.....)))))).))).)))))).).((.((((((((...)))).)))).)).....((((((((((..(((((.((((((((...))))........)))))))))............(((((((....)).))))).....(((....)))....))))))))))((((.((((......))))))))...((.(((((((((...)).))))))).))(((((.(((((..((.((((.(....)))))))..))))).)))))..))))))))...((((.......(((.....)))....))))...(((....)))((((((........))))))((...(((((((((.....)))))))))..))....((((((((..(((.((((.((((.(((((((..((....((((.(((((((......)))))))...)))))).))))))))))).)))).....)))..))))))))..........(((((((..(((((((((.........)))))))))...((((((......))))))(((.((((.....(((((((((((.(((((.((((((((......))))))))(((((((((.(..((....(((((......)))))))..).)))))))))............))))).))).(((((((.(((((((((.((((.....((....))(((((.......)))))....................)))).)))))))))......((((((.....(((..(((.(..(((.((..........)))))....).)))..)))..))))))((....))....((((((.((..(.(((((((((.........(((..((((..........))))...))).))).)))))))..)).))))))....)))))))((((((((...(((.(((((.((((.((((.((((.((((.((((.(......).))))....))))...)))).))))..)))).)))))..))).))))))))......(((((((....)))).)))...((((..(((((......)))))..))))......)))))))))))).)))......((((.(((((......))))).))))..((((((((((((((....(((.....))).((((.((((((...(((((.........)))))...))))))..)))).(((..((.(((((((((((((.((((((((.((((((.((((((..(((......))).)))))).))))))......(((........)))((((((......(((...((((((..((((((((...((.((((((.......((((((((((.((..((..........(((.(((((.....))))).)))...))..)).))))))))))..(((....)))))).))).))...))))))))..))))))))).......))))))....(((.....))).....(((((.((((.((((((...))))))...))))..)))))......((((((..((((.((((..((((((((((...(((..........(((..........)))......(((((((((((........(((((((...((((((((((.((((..((......((((.(((((..(((..(.............)..)))))))).)))).......(((((.(((((...))))).)))))((((.((((((.((.(.((...)).).)))))))).))))....((((.((((((((((.(((..(((((.((((((((...(((((((((((..((((((((...........)))))))).....)))))))).)))....))).....((..(((((((((...............(((((..(((((.((((((..((((.((..........(((((((((((((...(((((.......((..(((..((....))..)))..))..(((....(((((..(((((...................))))))))))....)))...))))).....))))))...........)))))))..)).)))))))))).)))))...)))))...)))))))))..))....(((((((((((.((((((....((((((((((.((((((((((((....(((((((((..(((((.............((((.(....((..((...((..(((........)))..))...))..))....).))))..))))))))))))))....((((....))))(((((((((.......((....(((.(((((.(((.((((((((.(((((.(((((((((..((((......))))..))))))....((((((((..(((.((..(((..(((((((((.......(((((.................((((((.(((((((.((((((....((((((..(((((.(((((((((...................((((((........(((.((((.((((((..(((((((.(((......((((....))))......)))....)))))))..(((....)))(((.....)))))))))....)))))))))))))(((((..(((((((((((......)))))..))))).)..)))))..)))))))))...)))))..)))))).((.......))....))).))).)))))))))))))..((((....))))(((...)))......))))).....)))))).))).)))..)).)))..))))))))..............))).))))).)))..))))).))).))))))))...)).......))))))))).....((((......)))).((((((((....)))............)))))(((((((((....((((..(((((.(((((.....)))))(((((.............))))).))))).)))).....))))))))).............(((((.((.((((....(((((((.............))))))).............(((((((.....(((((((((..((((...)))).)))))........(((((((((((((((...((((..................))))...)))........)))))))))))).........)))).......)))))))..)))))).)))))((((...((((((......))))))....))))))))))))).((((((.(((((((......))))))).)))))).....((((((....))))))....)))))))))))))...((((((....(((((......)))))...)))))).)))))).......((((.........))))............))))))..)))))...((((((((((((..(((.....((((((.......)))))).....)))..))))))))))))..(((((((((((((.........................((((.((..(((....)))..)).))))...))))))))))))).....))))).)))))..))).)))))))))).)))).))..)))).))))).)))))....))))))).........))))))))))).))).......))))))).)))..)))).)))))))))))))))))).)))))........................)))))))))))))........)))))))))))))).............))))))))))).))....
Thermodynamic Ensemble Prediction
.((.(((((.((((((,.(.((((((.(((((((((.....)))))).))).))))))||,|{{(((((((({,{||||.|,|,,{{{.,{,,,{{{{,|||}.|{,||,||||||||..,))))}....{|||||,||}}|,,,,,{{,,...(((((((....}).)))))..{{{({{,{{||||.{{.||||}|||||(((,,((((......))))))))..,|,}|,,|}}}}))})}),},}))))}).{((((.(((((..((.((((.(....)))))))..))))).)))))},))))))|{({{({,,.,{,,..,,,....})))...})))}....{,....},|(((((({{.{{{..|}}}})}}{{{((..,{{{,{{{{,{|||,,,,{||||,..|}}}}}}},,.,.}}}}}({({...}))).}},,))}}}}|||,.(((((((......)))))))...}}}}|,((((((,{({(((,{({{{(((((.{.(((((((.(((((((........((((.(.(((((((((((((...((((((....))))))((((((((((((((((.((((,,{,...,,{{{{{|{{|,.{{.((((((((......)))))))}},..{{(.((((((((.(((((..((((((.((((....))))(((((((((({{.,(({(,,{{{{,,.,|||.||...(((((((((.((((.{.,.{,....|}{((((,,,....}}}||.................,.,)))).)))))))))...,,.((({{{.,,{.{{{..{{{,{,.{{.,{{.,........}}}}|,...},})}..|||..}|}}}|,},..||}}.|||}},.||..,}}}|||.....}}......||{,{(({((((((.{(((({...((..(((((((.(((((.((((((((((,......,{,{,.((((((((...{{(.(((((.((((.{(((.((((.((((.{(((.(......}.)))),...))))...)))).))))..)))).)))))..,}}.))))))))...{({(((,{({....,})}.}}}.},}||..,{{((({{{,,{{|{((.{{(((..{{.{,,,.,}.)}}))}}...,,.)))))))))))}}.}}}}}})}},|}}}||,,.||.,.|{{..(((.((((((((({...((((,{(((((..,(((((....,,,.,)}}}}...}}}}}}..}}}}...,,,,,,|,..{(({{{{{..,))}},))}}|{{{,.((((((,,{({....,.})).})))}),)))}}},,.,..,||......,,|,.((((((.,,...({(,..((((((..((((((((...((.((((((.......(((((((((({(({.,,......,,..((({(({{,.....}}))).))).,,))},),.})))))))))..(((....))))))}})).))...))))))))..)))))))))....,,.))))))....|||.....}}}.....{((((.{{{,.(((((({{..,,)))}}}))})..)))))..........................}))))))).)).)))..))),,.,}||,}....}}....((.(((((.....(((((.......)))))...,...))))).))....}}))))).})))}...))).))))..))...}))))).,,}})))},,}},}}}.})))))))))))(((((.(((((...))))).)))))....)))))).))))).....))))))))})}.....{((((((((((((.{,({(({.((({{..{,{{{({..{{{,,,,{{(((((((((..((((((((...........)))))))).....)))))))),}}|..,.,.}}},},||,.(((((((((.,,....,,,.,,{,{{{{|,,{((((.((((((..((((.{{.,........(((((((((((((...(((((.......((..(((..((....))..)))..))..{((....(((((..(((((..{{........}}.....))))))))))....})}...))))).....))))))...........)))))))..)).)))))))))).))))}...}}}})...))))))))),.))}},.,,,,,,,......,..,,.....}})))).))))),})))))}})))))},|,...,,,|{....||,,}}}}}}}}))))..,.....,.(((........)))|||....,}})))))))).............)))))))).))))).))))).........{((({.,......)}}))..)))))))..)))))))..}.))))).{||,,,,,,,}))((({{(..({{(......)))).,)))))).(((((.(((((,{((((.(((..((((({.((..{,...|,.,)).))|..(((.(((.,(,.(((((((((((.(((((((((..,,..((((({,(((((((((((.(((((...,,,......,........{{.(((((((((((..((((((((((((((.{.{(((,..(((((.((((((....((((((((((((.,,...(((((((((,(((((((.....))).))))...{(((......))))((((((...((((({((((......))))}..))))).))}))))))))))))}(((.......)))....((((,....,))))....(((({..........,{((({.,......,.))))}|..,,,,......))))).,,)))}}))))))))......)))))).)))))...........}))).,)))))}.....)))).),}))...))))))))))).}}{{{({{{{,.{{{.,{{||...{(((......)))},{(({{{||,,,.||{,..,.......,)))}.(((((((((....((({..(((((.(((((.....)))))(((((.,,......,,..))))).))))).)))).....)))))))))..,.......,,...,,}}{{{{((((.,.,((((((,,,..........}}}}}},,,,,.............,}}|,,,{{,,{(((({..((((,,,||||,|||||,.,.....{{((((((((((.,,...({({........,,,.......))))||,,....,,,...)))))))))))),}}|||||,,,}}}}}})}...,,.,|||,|,}}}|,|}|,(((({{{(,,,,,.}}}}}))),,,....,,}))))).,)}}}||((((.(((((((......))))))).))))|{((((((.({((((((((((((...))))))))}})))....,{((({....{||{{....,,||}}}...,)))))).)))))))},,,|{{{{..{{|{{||,,||,.............))})))))},)}|||(((((((((((..{||,,...((((((.......)))))),}}},}))..)))))))))}},,.(((((((((((((.{,.......,..............((((.((..(((....)))..)).))))...)))))))))))))...))))).)))))))....)))))))))),}..)))))))))...)))))...)))))).}}.)))))).{{((((((......)))))))}.(((((((.....((((........)))).....)))))))...})))..))).)))))))))).)))))...,|{{(((((........)))))}.....)))}),)))})))))))}........))))).))....

Transcripts

ID Sequence Length GC content
AAUAAGUGGUGGUUACUCAGCACUUUUAGAUGCUGUUUAUAAUAGAUGA… 3865 nt 0.3656
AGUGCACAGUGCUGCCUCGUCUGAGGGGACAGGAGGAUCACCCUCUUCG… 3946 nt 0.3938
AGUGCACAGUGCUGCCUCGUCUGAGGGGACAGGAGGAUCACCCUCUUCG… 3819 nt 0.3941
Summary

This gene encodes the alpha subunit of transcription factor hypoxia-inducible factor-1 (HIF-1), which is a heterodimer composed of an alpha and a beta subunit. HIF-1 functions as a master regulator of cellular and systemic homeostatic response to hypoxia by activating transcription of many genes, including those involved in energy metabolism, angiogenesis, apoptosis, and other genes whose protein products increase oxygen delivery or facilitate metabolic adaptation to hypoxia. HIF-1 thus plays an essential role in embryonic vascularization, tumor angiogenesis and pathophysiology of ischemic disease. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2011] CIViC Summary for HIF1A Gene

Forensic Context

A study in human blood, saliva, and semen stains demonstrated that the HIF1A mRNA, a hypoxia-sensitive marker, shows a quadratic or cubic decrease in expression over four weeks at room temperature and can be used in predictive models for stain age estimation with a mean absolute deviation of ±2.1 to ±5.0 days [Fisal Asaghiar; Graham A Williams DOI:10.1016/j.scijus.2020.09.001]. In human forensic autopsy tissues, the HIF1A mRNA degraded gradually postmortem at a rate parallel to GAPDH, with its relative quantification (HIF1A/GAPDH) remaining largely stable for up to 48 hours in brain, kidney, and lung tissues, though a deviation was noted in the myocardium [Zhao, Dong; Zhu, Bao-Li; Ishikawa, Takaki; Quan, Li; Li, Dong-Ri; Maeda, Hitoshi DOI:10.1016/j.legalmed.2005.09.001]. A study in rats demonstrated that the HIF1A is a dominant regulator of cellular reactions to hypoxic stimulation, accumulating under hypoxia by blocking ubiquitination and degradation, though not through transcriptional regulation at the mRNA level [Zhao et al. DOI:10.1016/J.Forsciint.2015.08.007]. In mice, the HIF1A is established as a protein marker for the postmortem diagnosis of asphyxia [Yatsushiro et al. DOI:10.1007/S12024-025-00981-1].