Basic Information

Symbol
HLA-A
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class I, A HLA Class I Histocompatibility Antigen, A Alpha Chain HLAA HLA Class I Histocompatibility Antigen, A-1 Alpha Chain MHC Class I Antigen HLA-A Heavy Chain Leukocyte Antigen Class I-A Human Leukocyte Antigen A
Location (GRCh38)
Forensic tag(s)
-

MANE select

Transcript ID
NM_002116.8
Sequence length
1535.0 nt
GC content
0.5909

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-621.20 kcal/mol
Thermodynamic ensemble
Free energy: -647.40 kcal/mol
Frequency: 0.0000
Diversity: 303.67
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...((((((((((.((((.(((.(((((.((((((.(((.((.....(((((..(((((((..((((((((..((((.(........).)))))))))))).(((...))).....(((((((((((((((((((((((..((((((...(((((((((((((..(...((((.(((((.((...(((.((.((.......)))).))).))))))))))).)..))))))).)).)))).))))))............)))))))................))))))).)))))))))..(((((...)))))...)))))).)..))))).....)).))).........(((((...(((((.(((((((.((((.((.....)).)))).((((.(.(((((((....((.(((((((.((((((...((((((((...(((.((..(((............))).....))))).))))).....))).)))))).)))...)))).))..)))).))).))))).))))))).))))).....((.((..((..((...(.((...(((..((..((((((((.((((.((((.......((((.....))))..)))).)))).)).))))))..))...))))).).))..))..)).)).......))))).))))))))))).)))..))))))))).(((((((((((.((((.(((........))).((((....))))..)))).)))..)).)))))).((((((((((..((((((((((((.(((((((((((..(((((((((((.(.((.((....)).)).))))))))).))).((((........))))(((.(.(((..((((((.((.....)).))))))..)))).)))((.((((......)))))).))))))))...(((.....)))))).))))))).)))))...)))))((((((((.......))))))))..)))))....((((((((((((((((((........(((((((((....((((.(((((((((.(((((((.(((...))).))).........)))).))))))..))).))))((((.......((((((((..(((.((((.((.....)).))))....(((((((((..(((((........)))))..)).)))))))..((((((((..........))))))))......(((.((.(((((((......))))))))))))(((......))).))).))))))))....)))))))))))))..............(((.(((..((((((((((.((((((....)))))).))))).))))).))).))))))))))....))))))))))).(((.......)))......((((......))))((((((((((...(((......)))((((......)))).((((......))))..)))))))))).........(((.....))))))))
Thermodynamic Ensemble Prediction
...{(((((((((.((((.(((.(((((.((((((,(((,((,....,{(,,..{{,,,,,}}||||((((.,({{(,{...,,,..}.)))}|||}||||,.((({{..(({...{((((((((((((((((((((((..((((((...(((((((((((((.{{.{,((((.(((((.((...(((,{,,{{,,,,..,})}}.})).))))))))))),..,)))))))},).)))).))))))........,,..))))))).....{{....},,..)))))))},)))))))}..(((((...)))))})),,))))}..,})))},}}.,},,}||,........{||||},.(((((.(((((((.((((.((.....)).)))).((((.(.(((((((.,..((.(((((((.((((((.,.((((((((...(((.{{..(({..,{......,,}}),,...}}))).))))).....})),)))))).)))...)))).)),.)))).))).))))).))))))).)))))}..,.((.{{.,{,..{{.,.|,||...{((..((..((((((((.((((.((((.......((((.....))))..)))).)))).)},))))))..))..,)},,}.,.,,..}}..}}.})....,..}}}}).))))))))))).)))..))))))))).(((((({((((.((((((.,,{.((,...})},}}.,}}),))}.,|||}|||||||}.}|||||.((((((((((..((((((((((((.(({((((((((..(((((((((((.(.((.((....)).)).)))))))))}})).((((........))))(((.(.(((..((((((.((.....)).))))))..)))).)))((.((((......)))))).))))))))...{{{{,,..}},))).)))))))}}))))...))))){||{{{{|,,,....))))))})..))))),,{.((((((((((((((((((...,,...(((((((((.,,,((((.(((((((((.(((((((.(((...))).))).........)))).))))))..))).)))){{{{.......((((((((..(((.((((.((,...,)).))))....(((((((({..,((((........))))}..}}.)))))))..((((((((..........))))))))......{{{.((.(((((((......))))))))))}|({,.....,),,.))).)))))))).,..}))))))))))))....,.........(((.(((..((((((((((.((((((....)))))).)))))},)))).))).))))))))))....)))))))))))}|||,,.....}}}....,,||{{...,,,|},{((((((((((,,,{((......))}{{{{......}}}}.((((,....,))))..})))))))))}..,,,...(((.....)))))))}

Transcripts

ID Sequence Length GC content
AGAUUCUCCCCAGACGCCGAGGAUGGCCGUCAUGGCGCCCCGAACCCUC… 1535 nt 0.5909
Summary

HLA-A belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen so that they can be recognized by cytotoxic T cells. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. More than 6000 HLA-A alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.[provided by RefSeq, Aug 2020] CIViC Summary for HLA-A Gene

Forensic Context

No relevant information is available at the moment.