Basic Information

Symbol
HLA-B
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class I, B HLA Class I Histocompatibility Antigen, B Alpha Chain HLAB AS MHC Class I Antigen HLA-B Alpha Chain MHC Class I Antigen HLA-B Heavy Chain MHC HLA-B Transmembrane Glycoprotein MHC HLA-B Cell Surface Glycoprotein Leukocyte Antigen Class I-B HLA Class I Antigen HLA-B MHC Class I Antigen SHCHA Human Leukocyte Antigen B Ankylosing Spondylitis MHC Class I Molecule MHC Class 1 Antigen B-4901
Location (GRCh38)
6:31353867-31367067
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Forensic psychiatry evaluation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_005514.8
Sequence length
1536.0 nt
GC content
0.5892

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-601.50 kcal/mol
Thermodynamic ensemble
Free energy: -627.32 kcal/mol
Frequency: 0.0000
Diversity: 298.29
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((....)))...(((((.(((....))).)))))(((((((((.(((((((((.((((.(((((((...(((((...(((((((((((((((.((((((((...((.(((...(((...((.(((((((((((((((((((((((....)))))(((.((((..((((((.(((((.((..(((((.....)).)))(((....)))))))))))))))).)))).)))(((((.((((((((.((.(..(.((((((.((((..........))))................((((((.(((.....(((......(((((((((((...))))).)))).)).....)))......)))))))))....)))))).)..))).)))))).))..)))))))))))..((((((.(((((((.(((((((........(((......)))........))).))))))...)))))...)))))).......)))).)))))))).))...)))..))))).....)))))))).)))))))..((((..((((((((...((((((.(((.(((((.....(((((.((((((((........)))))...(((..((...(((........)))...)))))...............((((((((((((.(((((((.(.(((....))).))))(((((...((((.((((((((((((..((.(((...))).))....))))).(((......)))..(((((....)))))...))))))))))).))))).((((.......)))))))).))))).....)))))))(((((((....)))).)))(((((.....(.((((.(.(((..(((((((((.....)))))))))..)))).)))).)...))))).))).)))))))))))))..)))))).)))))))).))))((((((....))))))..)))).))))....).))))))))))).)).))))))))))).).)))).)).))....((((((......(((((((((...((((((..((((((.((((((........(((((((((.((((...))))..(((((....)))))))))))))).(((((((.(((.(((((((((.........))))).....))))..))).))))))).....(((..(((((......))))))))).)))))...((.(((.(((((((((((((((..((((((........(((......)))............((((................))))(((((((((......)))))))))))))))....))))))))))...))).)).))).)))))))).))))))..((((((.(((......)))..))))))...........((((((((((((((((........(.((.(((((((..(((.....)))..))))))).)).).))))))))))))))))..)).))))))).)))))).
Thermodynamic Ensemble Prediction
.,,{.,{,{{|...(((((.(((....))).)))))(((((((((.(((((((((.{(((.(((((((,,.(((((,{,((({((({,((((((.((((((((...((.(((...(((...((.(((((((((((((((((((((((....))))){((.((((..((((((.(((((.((..{{{{{..,,,)}.}}}{{{....))}))))))))))))).)))),)),(((((.((((((((.((.(..(.((((((.((((..........))))................((((((.(((...,.(((.....,{{(((({((({...})))).)))).)).....)))..,...)))))))))....)))))).)..))).)))))).))..)))))))))))..((((((.(((((,,.(((((((........(((......)))........))).)))),}...)))))...))))}),......)))).)))))))).))...)))..)))))..,..)))))))).))))))|..((((..{(((((((...((((((.(((.(((((.{{{.{(((({((((((({{,,....|})},,...(((..((.,.,((.,...,.|))),.}}.}}}.....,....|},..((((((((((((.(((((((.(.(((....))).))))(((((...(({((((((((((((((..((.(({...})).))....))))).(((......)))..(((((....)))))...))))))))))).))))),(({{......,))}})))).))))).....))))))){((((((....)))).)))|||,,.....|.{(((.(.(((..(((((((((.....)))))))))..)))).)))),)},,)}))),))).}})))))))))))..)))))).)))))))).)))),(((((....))))))..)))),}})).}},).))}}))))))).)).)}))))))))).).)))).)).))...,||||(({{....(((((((((...((((((..((((((,(((((({{{{,.,,((((((((({((({...})))..{((((....)))))))))))))).((((({{.,{|,|||{{((({.........})))),.,,,))))}}}))})))}}}}....,||,.,(((((......))))))))}.}}}}}...{{.,,,.(((((((((((((((..((((((......,.(((....,.}}}....|.....,.|{,|,.,,{.|.........))),(((((((((......)))))))))))))))....)))))))))),..)})}.}.,}}.}})))))).)))))}.,((((((.(((......)))..))))))...........((((((((((((((((...,.{{,.,,(,{((((((..(((.....)))..)))))))})))),))))))))))))))))..)).))))))).,})))).

Transcripts

ID Sequence Length GC content
NM_005514.8 NCBI
AGAGUCUCCUCAGACGCCGAGAUGCUGGUCAUGGCGCCCCGAACCGUCC… 1536 nt 0.5892
Summary

HLA-B belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from the endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon 1 encodes the leader peptide, exon 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. Hundreds of HLA-B alleles have been described. [provided by RefSeq, Jul 2008] CIViC Summary for HLA-B Gene

Forensic Context

A study in humans identified the HLA-B as a key hub protein from a protein-protein interaction network in cardiomyopathy, with receiver operating characteristic analysis showing an area under the curve of 0.738, indicating its diagnostic and prognostic potential [Rahman et al. DOI:10.1038/s41598-024-78011-3]. In a separate human study of chronic traumatic encephalopathy, transcriptome analysis found the HLA-B was specifically up-regulated, implicating it in the cell adhesion molecules pathway unique to this head trauma-related neurodegenerative disorder [Cho et al. DOI:10.1038/s41598-020-65916-y].