Basic Information

Symbol
HLA-C
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class I, C HLA Class I Histocompatibility Antigen, C Alpha Chain HLA-JY3 D6S204 PSORS1 HLAC Major Histocompatibility Antigen HLA-C MHC Class I Antigen Heavy Chain HLA-C Human Leukocyte Antigen-C Alpha Chain Psoriasis Susceptibility 1 Human Leukocyte Antigen C HLA-C Antigen HLA-Cw HLC-C MHC
Location (GRCh38)
6:31268749-31272130
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Forensic psychiatry evaluation
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002117.6
Sequence length
1542.0 nt
GC content
0.6005

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-641.20 kcal/mol
Thermodynamic ensemble
Free energy: -667.90 kcal/mol
Frequency: 0.0000
Diversity: 371.96
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
...(((((....(((((.((((((.(((.(((...((((((.((((..((((((((.(.((((((((....(((((.(........).)))))..))))).(((...))).......(((((....))))).((((..(.((((((....((((.(((...(((...(((((.((((.....)))).)))))..((((((((....))).))))))))...))).))))..)))))).))))).))).).))))))))))))))....((((((...(((((.(((((.((((...((((.((((.((((((.((...)).)))))).)...)))))))...)))).....(((.(.(.(((((((..((((.(((((((((((.(.((.((((((..((....(((..((((((((((((.....(((((((...((((((((......)))..))))).))).))))........(((.((((((....(((.(((((((...)))))))...).))....)))))).))))))))).))))))..))))).)))))))).).)))..))))))))(((((.(((((.((((((((((((...((((.....))))..(((((.(((.(((.((.(((.................(((......)))..((((.........)))).((((....))))))).)).)))))).))).)))))))))).))))..(((((..((((((((((((..(((((..((((.(((((.(((......)))((.(((((((((((((((((((...(((((((....(((..(((((.(((((((.(((((........)))))......)))))))..)))))..((((((((.....)))))))).)))....)))))))))))))))...(((((............))))).....)))))))))))))))))))))))))))..)))))))....))))))))))...))))))))))...(((......))).((((((...((.((((((((.(((((((((...((((.....((((...(((((((....))))).))...)))))))).))))))))))))))((((.(((((((..(((((((.(((.(((((((((.........))))).....))))..))).))))))).))))))).)))).......(((.(((.((..(((.((.(((...))).)).))))).))).))).....)))))...))))))))))..))))))).).).)))..))))))))))..))))))((((((((........))))))))))))...))).))))))))).)))))..(((((.((((((......)))....(((((((((......)))).)))))))))))))....((((((.((((((...((((.(((.((...((((((..(((.....)))..)))))))).))))))))))))).))))))........)))))..........
Thermodynamic Ensemble Prediction
...,((((....(((((.((((((.(((.(((,{{((((((.((({.{((((((((.,.,,,(((((,{..(((((.{........}.))))).}))))).{,,,..}}}|,.....{,,{|,||||}},}.||||{{{.((((((...{(((({((({.{(((.,((((((.(((({.{{.,,|{{||,,|{,|||,,{||,,.})).}))))))))}}}).)}))))}}})),))}),)))})),})|))))))))))))}}|...{(((((...(((({{(((((.{(((...(((((((((.((((((.((...)).)))))).)...))))}))...)))).....(((.(.(.(((((((..((((.(((((((((((.{.((.((((((..((....(((..((((((((((((..,,.(((((((...((((((((......)))..))))).))).)))),,......{((.((((((..,,({,.(((((((...)))))))...).})....)))))).))}))))))}})))))..))))).)))))))).).)))..)))))))){,{(({{((({(({{.||||||.....((((.....))))..||||,||||,|||,||}|||.....,,...,,,,{,.{{{.,,{,.|||,{((((..,..,,..}}||,{,,,..,.)))).}}))}}|((((({{|{.{{{{(({,|,,{|||..(((((.,((((((((((((..(((((..{{{(((((((,(({......})){{.(((((((((((((((((((...(((((((....(((..(((((.(((((((.(((((........)))))......)))))))..)))))..((((((((.....)))))))).)))....))))))))))))))),..(((((..,,....,,..))))).....)))))))))))})))))))))))))))..)))))))....))))))))))..,,..}}}),)))})),}...}}))))}|||||{...||,|||(((((.((((((((({{.,,,,}}.,,((((...{((((((....)))}),))...)))}})),.))))))))))))))((((.(((((((..(((((((,(({.(((((((((.........))))).....))))..))).))))))).))))))).))))....,..{||,|||,||},{{|,{,.||,...,}}.,||}||||{}}}.}}}.,}}}))))).,.)))}}}))))..))))))).).).)))..))))))))))..))))))|{{{{{{||||...}}))))))))|}))...})).))))))))).)))))..{((((.((((({......))),..,(((((((((......))))},)))))))))))}....((((((.{(((((,..,{{{.(((.((,..((((((..(((.....)))..)))))))).)))}}})))))),.))))))......,,)}}},.....,,,..

Transcripts

ID Sequence Length GC content
NM_002117.6 NCBI
ACAUUCUCCCCAGAGGCCGAGAUGCGGGUCAUGGCGCCCCGAGCCCUCC… 1542 nt 0.6005
Summary

HLA-C belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. Class I molecules play a central role in the immune system by presenting peptides derived from endoplasmic reticulum lumen. They are expressed in nearly all cells. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domain, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. Polymorphisms within exon 2 and exon 3 are responsible for the peptide binding specificity of each class one molecule. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. About 6000 HLA-C alleles have been described. The HLA system plays an important role in the occurrence and outcome of infectious diseases, including those caused by the malaria parasite, the human immunodeficiency virus (HIV), and the severe acute respiratory syndrome coronavirus (SARS-CoV). The structural spike and the nucleocapsid proteins of the novel coronavirus SARS-CoV-2, which causes coronavirus disease 2019 (COVID-19), are reported to contain multiple Class I epitopes with predicted HLA restrictions. Individual HLA genetic variation may help explain different immune responses to a virus across a population.[provided by RefSeq, Aug 2020] CIViC Summary for HLA-C Gene

Forensic Context

A study in human post-mortem brain tissues demonstrated that the HLA-C was specifically up-regulated in chronic traumatic encephalopathy (CTE) compared to normal controls, Alzheimer's disease (AD), and mixed CTE/AD cases, as part of a cell adhesion molecules (CAMs) pathway alteration identified through transcriptome sequencing and differential expression analysis [Cho et al. DOI:10.1038/s41598-020-65916-y]. A study in humans demonstrated that the HLA-C is a highly expressed housekeeping gene with a low coefficient of variation across individuals differing in genetics, environment, age, and gender [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].