| ID | Sequence | Length | GC content |
|---|---|---|---|
| GGAGUUGGGGAAGCUGGGUUGGCUGGGUUGGUAGCUCCUACCUACUGUG… | 1093 nt | 0.5306 |
HLA-DMA belongs to the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta chain (DMB), both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and the cytoplasmic tail. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the HLA-DMA was upregulated in monocytes from septic mice compared to sham controls and was selected as a key gene in a machine learning model for sepsis identification, achieving high diagnostic accuracy with an AUROC of 0.904 and 0.924 in independent human test datasets [Li et al. DOI:10.1007/s00011-025-02068-7]. In human sepsis patients, single-cell RNA sequencing analysis found that the HLA-DMA exhibited reduced expression specifically in CHIT1+ neutrophils from non-survivors, associating this downregulation with a pro-inflammatory and immunosuppressive neutrophil phenotype [Li et al. DOI:10.1038/s41598-025-99619-z].