Basic Information

Symbol
HLA-DMB
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DM Beta RING7 D6S221E HLA Class II Histocompatibility Antigen, DM Beta Chain Really Interesting New Gene 7 Protein MHC Class II Antigen DMB Class II Histocompatibility Antigen, M Beta Chain MHC Class II Antigen HLA-DM Beta Chain MHC Class II HLA-DMB DMB
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002118.5
Sequence length
1348.0 nt
GC content
0.5252

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-466.60 kcal/mol
Thermodynamic ensemble
Free energy: -490.94 kcal/mol
Frequency: 0.0000
Diversity: 371.81
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.((((.(((((((.(((((.((((...((((.....))))..((((((((((((((((...........))))(((((....)))))(((((...........))))).(((((((..(.(((....(((((((((((.....(((.((((((((((..(((.(..(((((((........)))))))..).....((((((((((((((((((.(((.((....((((((....((((((((.(((.((((...)))).))).)))..(((((.....))))))))))..))))))...))..))))))).)))).))))))))))((((...((((((((((....(((..(((((....)))))..))).....)).))))))))...)))).......)))..))))))....(((((((((((...((...(((....)))..))..))))))))))).......((..(((...(((.((....)))))..)))..))....)))).)))......)))))))....))))......))).)..)).)))))(((((.((((((.((.....))))......(((((((......))))))).....)))).)))))(((..((((((((((.(((.(((..((...((((...)))).))..))))))(((((...)))))...)))))))).))..))).....)).))))))))))...(((((((((.....))))....))))).......))))...((((......))))....(((((((.(((((......)))))((((((.((.(.(((((..(((((((.(((.(....((((......))))).)))..)))))))(((.((((....)))).)))..)))))).))))))))..............))))))).))))).)))).)))))))(((((((((((.(..((((((..((((((......))))))....((((((((((.....(((((.............(((((((...)))).)))(((((((((((......((((..((((((....(((((.....(((......))).......)))))...)))))).....))))......)))))))))))..(((((((...(((........)))....))))))).(((((((.((((.((((((.....(((....))).....))).))).))))))))))).......((.((((.(((.........))))))).)))).)))))))))))))))))))..).))))))...(((((((...))))))).....)))))...
Thermodynamic Ensemble Prediction
.((((.(((((((.(((((,{{((..,((((.....)))).,((((((((((,{((((.{,.....,,.))))(((((....)))))(((((..,....,,..))))).(((((((,.(.{{{....(((((((((((,....(((.{({,((((((..(({,(..(((((((........)))))))..).....(((((((((({({(((((.(((.((.,..((((((.{({(({,((((,(((,((((.,.)))),))).})},}).,))))).{{({....)))).))))))...))..)))))))}.})).))))))))))((((...((((((((((....(((..(((((....)))))..))).....)).))))))))...)))).......}))..))))))....(((((((((((...{(...(((....)))..}}..))))))))))).......{{..{((,,.{((,({...,)))))..))),.))....,}||.}}}....,.)))))))...,))))......))}.}..)))}))))(((((.((((((.((.....))}}......(((((((......)))))))...,.)))).))))){{(..(((((((((({(((.(((..({...((({...)))).)),,))))}}{{(({...))))}...)))))))},)),.))}.....}}.)))))))))){{{(((((((((.....))))....))))),)}}...)}}}...((((......))))....(((((((.(((((......)))))(((((({((.(.(((({,((({((((,(((,{..,,((((,,,,..}}}}|||||,|}}.||}}}.,}},|.}}}})))}.)},..}))))).)))))))}..............))))))}.))))).)))).)))))))(((((((((({.,..((((((,.((((((......)))))).,,,{((({{{{{{..,,|((({{,,...,,.....{{((((({...))}),)))|((((((((((......((((..((((((....(((((.,,..(((......)))....,,.)))))...)))))).....))))......))))))))))},.{{{(((({{{(((........))}...,))))))}.((({{(({((((.((((((.....((,....})).....))).))).)))}))))))).......||.|||},|||,,,......}|})},}})))),)}})))))))))))))))},,}.}})))).,.{{(((((...)))))}}.},..)))))...

Transcripts

ID Sequence Length GC content
ACUGGACUCCCGUGAGCUGGAAGGAACAGAUUUAAUAUCUAGGGGCUGG… 1348 nt 0.5252
Summary

HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]

Forensic Context

A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal gene expression at single-cell resolution, identifying 12 cell clusters and showing Pb treatment was associated with a 12.4% increase in oligodendrocyte proportion [Bakulski et al. DOI:10.1093/toxsci/kfaa069]. A study in mice demonstrated that the HLA-DMB mRNA was significantly dysregulated in lung tissue 48 hours after 12 Gy thoracic irradiation and was functionally annotated to be involved in Th1 and Th2 cell differentiation, Th17 cell differentiation, and hematopoietic cell lineage pathways, indicating its role in the early competing endogenous RNA network of radiation-induced lung injury [Li et al. DOI:10.1177/1559325819891012].