| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGACUCCCGUGAGCUGGAAGGAACAGAUUUAAUAUCUAGGGGCUGG… | 1348 nt | 0.5252 |
HLA-DMB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DMA) and a beta (DMB) chain, both anchored in the membrane. It is located in intracellular vesicles. DM plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP (class II-associated invariant chain peptide) molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that perinatal lead (Pb) exposure altered adult hippocampal gene expression at single-cell resolution, identifying 12 cell clusters and showing Pb treatment was associated with a 12.4% increase in oligodendrocyte proportion [Bakulski et al. DOI:10.1093/toxsci/kfaa069]. A study in mice demonstrated that the HLA-DMB mRNA was significantly dysregulated in lung tissue 48 hours after 12 Gy thoracic irradiation and was functionally annotated to be involved in Th1 and Th2 cell differentiation, Th17 cell differentiation, and hematopoietic cell lineage pathways, indicating its role in the early competing endogenous RNA network of radiation-induced lung injury [Li et al. DOI:10.1177/1559325819891012].