Basic Information

Symbol
HLA-DPB1
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DP Beta 1 HLA-DP1B HLA Class II Histocompatibility Antigen, DP(W4) Beta Chain HLA Class II Histocompatibility Antigen, DP Beta 1 Chain MHC Class II Antigen DPB1 HLA-DP Histocompatibility Type, Beta-1 Subunit MHC Class II HLA-DP-Beta-1 MHC HLA DPB1 HLA-DPB HLA-DP DPB1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis

MANE select

Transcript ID
NM_002121.6
Sequence length
3991.0 nt
GC content
0.4573

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1181.00 kcal/mol
Thermodynamic ensemble
Free energy: -1261.59 kcal/mol
Frequency: 0.0000
Diversity: 976.72
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((..(((((...(((((((....(((((..((((....(((((((((((.....(((.(((((((.((.((.((((((((((...((((.((((.((.((((.(((.(((((((((((.(.(((....((((((((((((((.((((((....((((((((((((((((.((((....))))..((((....((.....)))))))))))))))))............((((((....((((((((((.....)))).))))))....))))))..))))).....)))))).))))..))))......((((.....))))........))))))..))).).)))))))))))..))))))))))))).....))))...))))).))))))).)).))))))).)))((.((((((..........(((((((((.((((...(((((((.(((..((........(((((((((((........))))........))))))).......)).))).)))))))...))))..)).))))))))))))).))(((((..(((.(....(((...((((.(((.((((..(((((...((((((.((((((........))(((((((((((....)).).)))))....))))))))))))).)))))..)))).))).)))))))))))..))))).((((.(((((....))))).)))).......))))))))))).....((((((((.......((((.(((((((((((....)))).((((((((((......))))...(((((.(((((....(.((.((((((((..((((..((.((((..((((((((((((...((...(((((........)))))....))))).....((((((((.((((((....((((.((((((....(((......)))..)).)))).)))).....((((.(((((((((...((..(((((..(((...((((((......((((((....((((((((....(((((((.(((..........))).))))))).........(((((((((..........((((((...........))))))..........(((((((.((.......(((.((((...((((((.................))))))))))..((((((((((....(((((.......(((((..(((.(((.(((.((...((......))..))...))))))))).)))))......(((..(((((..(((((......)))....))..)))))..))).(((((...)))))..(((((.......)))))..)))))....)))))))))).........))).......)))))))))...)))))))))..........))))))))......))))))....(((((......)))))...........................((((((......))))))..................((((((((....((((((((.....((((((.(....).))))))....))))))))))))..)))).)))))).((((((............)))))).......(((((...)))))..)))..)))))...((((((((((((.....((((..((((.((((..((((((((((..((((((((((......)))))....((.(((((..(((((((....((((.(((.(((.(((((((((......(((((((((((.((((((.((((..((((((((((((((((((........((.((......)).))........(((((..(((((....((((.....))))........)))))..)))))((((((((((..((...(.((((((((((((((..(((....((((.(((((((((....(((..((((((..((.((........)).))..))))))..)))...((((.......)))).(((((.(((.(((.......))).))).)))))(((...................))))))))..))))...))))))).))).)))))))..))))...)...))..))))))))))........((.((((((((((.((((((((..((((.....)))).........................((((...(((((((.(((((..((((((((............))).)))))..))))).......((((((((...((((...............(((((((((((((((.(((.((............)).))))))))).....)))...))))))(((((((...))))))))))).))))))))((((.......)))).........))))))).....)))).)))))))).)))))))..)))))..(((((......)))))...........((((((.(((.(((((((((..((((..(((((((..(.((.(((.......................(((.((((.((((((.....))))...((((((....(((((((....).))))))...))))))......)).))))))).......(((((.((.((....)).))..))))).))).)))..))))............)))...)))))))))))))...)))..)))))))))))))))).)))))))))))))))....))))))))))))))..))))))))))))))).))))......)))))))))))).))....)))))..))))))))))((.(((..((.((((((((((((.(((...................)))...))))))))....)))).))..))).)).....(((....)))(((((....)))))))))))))....))))..))))))))))))..)).)))))))))))))...)))))).)))).)))))))))))))..)))).))..)))(((.((((((((.(((.....(((.(((((.((((.....((((((((((.(((((.(((((.(((((.....((((((((.((.((((.....((((((((....((((((...((((..((((((((..............(((((.((((((((.(((..(((((((((((((((.....................))))))))(((.........)))..(((((((((((((((....(((((((.......(((........)))......)))))))...)))))))...))..)))))).(((...)))))))))))))))))).))).))))))))))))))))).))))))...((.((((((..((((((.(((........((((.(((....))).))))...(((......))).))).)))))))))))).))((((.((((.............)))).)))).....(((...((((((...))))))...)))))))))))...)))).)).)))).))))...))))))))))...)))))))))))))))((((((..((......)).))))))................))))...))))).)))..((((((((((.........))))..)))).))))).)))))))).)))..)..)))))))).)).)..)).)))))))))))))).....)))))))))))....))))))))(((((((.............)))))))..))))....))))).........(..((((.....))))..)((((((((....)))).)))).....)))))))....((((.....))))))))).....))))).............(((((((.....................)))))))........
Thermodynamic Ensemble Prediction
..,{(((((,,....((((((((((((((((((((....,,,{((((,(((((((..(((.(((((((.{(.((.((((((((((...((((.((((.(,{((((.(((.(((((((((((.(.(((.,..((((((((((((((.((((((....{{{(({((((((((((.((((....}))}..{{{{|,..,{.....,}))}}))))))))))}.....,|,....((({{{,,..((((((((({.....}))).))))})...,))))}}..)))}}.....)))))).))))},))}},...,.((((.....))))........))))))..))).).)))))))))))..))))))))))))).....))))...))))).))))))).)).))))))).)))((.((((((..........(((((((,({((((...(((((((.{((,{({,.......,||||((,((({{..,,{,,||....,.,,.,,)))))},.....,,.})).)))))))...))))..)).))))))))))))).)){,.,,.....,,....{((,...}))}(((.((((..(((((...((((((.((((((......,}}|(({((((({{{....}}.}.)))))....})))))))))))).)))))..)))).)))..)))))))))))))){{..((((.(((((....))))).))))..}}..(((((((((((((...((((.(((((((..,.{(((((.,(((({....,}))).)))))),,||||..,...||||...{{(((,(((,,....|.{{.((((((((.,{,{{..,,.((((..((((((((((((..{{(...,|||(,,,,....})))),((({({.{{{{..,,..,,,({(((((,...{(((,.,,,,,{.}}}||}}}}}}.)))).))})))|{|||{{{.{{((((,(((((((((...((((.{{..(((.((..((((((.....{((((((.((((((((((................{{{,({({.((((((.(((((({((((.......,,{{{,..,,,....((((({...........})))))}}}..}}}......)))))..)))))).,}),,))).)))))}}.....))))}}})))).)))},}}|,,,,((({(({{((,...{,((({,,,...(((((.,(((.{{{.{||||{{(.,(,,,,..}}..},..,))))})))}.)))))......{((..(((((..((,,..,.....}}....})..)))))..)}|,(((,{,.{|||||{,(((((.......))))).{|||||{{,.}||,|||,},,,{..................,,,.,}|,|||,||}}|||||||}}}}}}}}.,|,|||||,,{{,.....,,.,,,,,......,,,)),,,,}.....,,,..,}..}}}}}}},{(((((......)))))}..................(((((((,....((((((((.....((((((.{....}.)))))).,..)))))))),,,,..)))),}}}}}..((((((.........,..)))))).......(((((...))))){{{{(....(({.....})).,,,|||}}.......,,{(((((({{{.{{{{,{({((,{(((,,.,{||,,,,},}}||,,,|.{{.(((((..(((((((.,..((((.(((.(({{(((((((((......(((((((((((.((((((.((((..((((((((((((((((((........{{|((......}}.}}........,((((..(((((.,..((((.....))))........)))))..))))|((((((((((..{{.,,(.((((((((((((({..(((....{({,.(((((({,.{{..{((({((((,({,{(.{(,.......,,.,,..||||||...,,.|}||||..,,.,})),)))))}))||,}},))}}}}},|||.|||.{|.{{|,,.|||,,...{{{.......))).,,))}})})},)}})))))).))).)))))))..))))...,...}),,))))))))))........,{.((((((((((.((((((((..((((.....))))...........,,,...........((((,{.(((((((.(((((..((((((((............)))))))))..)))))..,,,..,(((((((...((({,{{{,..........{((((((((((((((.({(.,(............}}.)))))))))}....,,}|,.,})))}(((((((...))))))))}}}.))))))))},,.,,|||,.,,}},,,......)))))))..,}.)))).)))))))).))))))}..)))}}..(((((......)))))......,....((((((.(((.(((((((({.,((((..{(((((...,.||}|}..{{........................{{{({,{(((({{{{{||||{,.((((((....(((((((....),})))))...))))))......))},))))))}.....}}}}}||{........))},||,,{{||.||}}}})}.}}}}..,|,.......,))...)))))))))))))...)))..)))))))))))))))).)))))))))))))))....)))))))))))))),.))))))))))))))).))))..,...)))))))))))).,|{{{{|||||{{|,,|}},}},,,},,}}},,}||,,||||||||,|||},..,,,,..,,,}},,}.}}}...|||||||}....,))).}},)}}}||.............)))}}})))))))}},)})})},))))))..})..))).},.,.))))....))))))))))}))..,))))))}))))..))))))))))))..)))).,,.,}|}(((.((((((((.{((...,,(,{,((({{,({{({{{..((((((((((.(((((.(((((.(((((.....((((((((.((.((((.....(((((((({...,(((,..}}|,{{,,(((((((({{........,...(((((.((((((({{(((..(((((((......{{{({,(({...{{,.....,,}}},,))|)|{,.........},,..(((((({{(((((((....(((((((.......(((.,....}.)))......)))))))...)))))))...}}..)))))).(((...)))))))))))))))))).))).))))))))))))}||||{||||,|{{{,{{({(((({..,,|||}|||,.......((((.(((....))).))))....,,...}}}),)))))}))),,|||||,,.,{((((.((((.........,,..)))).))))),...}}}}}.((((((...))))))}},)})))))))))...)))).)).)))),,)))...))))))))))...)))))))))))))))((((((..({......}).))))))................||||...,},,)})))}}|||,{||,,||,.,,,...|||...},)),,,))}.)))))))).)))..,..)))))))).)),|,,|}.}))))))})))),))))....))))))))...)))))..)))))))))))))}.,,...({,,,,.,,}..,||.....{{{{{........{({{{(......,)))).,.,,.}}||}..,,}|}),}}}},....})))))).,,..(((({...,{(({....))))))))),,}}..........(((((((.....................)))))))..,}}}}.

Transcripts

ID Sequence Length GC content
CCUUCUUUUCCUGACUGCAGCUCUUUUCAUUUUGCCAUCCUUUUCCAGC… 3991 nt 0.4573
Summary

HLA-DPB belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DPA) and a beta chain (DPB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B lymphocytes, dendritic cells, macrophages). The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DP molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to 4 different molecules. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans analyzing sepsis patient data identified the HLA-DPB1 as a prognostic biomarker, with its expression significantly higher in sepsis non-survivors compared to survivors and associated with 28-day mortality [Li et al. DOI:10.1038/s41598-025-99619-z]. Another human study investigating monocyte-related pathways in sepsis confirmed HLA-DPB1 participates in the MHC-II signaling pathway, where it binds to CD4, and its expression was found to be reduced in sepsis non-survivors [Liu et al. DOI:10.1590/1414-431X2025e14930].