Basic Information

Symbol
HLA-DQA1
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DQ Alpha 1 CELIAC1 HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain MHC Class II DQA1 DC-1 Alpha Chain DC-Alpha HLA-DQA HLA-DCA HLA Class II Histocompatibility Antigen DQ Alpha Chain MHC Class II DQ Alpha Chain MHC Class II HLA-DQ-Alpha-1 MHC Class II Antigen DQA1 MHC Class II Protein MHC HLA-DQ Alpha HLA-DQA1* HLA-DQB1 DQ-A1 DQA1
Location (GRCh38)
6:32628179-32647062
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002122.5
Sequence length
1574.0 nt
GC content
0.4581

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-430.40 kcal/mol
Thermodynamic ensemble
Free energy: -462.88 kcal/mol
Frequency: 0.0000
Diversity: 395.95
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((.(((((..........((((((((((((..((.((.(((((((....((((...))))......(((......)))(((((((.((((..........)))).).)))))).....((((((((((..(((.((.((((((.((((((.((.((((((...(((..((((.............)))).))))))))))).)).......((((.((((..((((.....)))).(((((((((((..(((((((((((....)))...(((((((.....((..(((.((((((.(((((((((((.(.((.....((((.(((.(((((((.((((((((.((((........((............))........)))).))))...))))....))))))))))))))))).))).)))((((....))))..........((((((...))))))..........))))))))))).))).))..)))))))...)))))))).(((.(((((.....))))).)))...))))))))))).((.(((((.............))))).))..)))).))))(((((((.(((..((((...))))....)))))).))))((.((((((((((((.((((((((((((..((..(((.((.((......)))))))..))))))))..((((((........))))))....))))))))))..)))))))))))))).)))))).)))))))))))))))..)))))))..)).))))))))))).))).(((....((((((..((((((......(((((((.(((((((((..............((((.((((((..(((..((.(((((...((((.........))))....))))).))..))).)))))).))))...............)))))))))))))))).....(((...............)))))))))..))))))....)))...(((....(((((((((..(((((((........(((((.........)))))((((((((((.(((....))))))))..............................(((((((((((((((.....)))))(((((..((((((................(((..((((((((((..(((.(((((...(((((((..((......)).....)))))))........................((.(((........))))))))))...))).)))).))))))))).....(((((....)))))))))))....))))).))))))))))............((((...))))..............))))).(((.((((((((((((...))))..(((...))).((((.(((((........................))))).))))...)))))))).))).((((....)))).....))))))).)))))))))...)))...(((((...))))).........)))))...)))..........
Thermodynamic Ensemble Prediction
,{{.(((((.......,..((((((((((((..((.((.(((((((,...((({...})))......,{{,,,.{.||,(((((({,((((..........)))).).))))))}}}}.((((((((((..(({{((.((((((.(((((,.{(,((((((,{{{,{..||||,,.,,,({{{,..,|}}}},||}||||||{||...,.|,||{{.{{{|,.{{{{.....)))),(((((((((((..(((((((((((....)))...(((((((.....((,.(((.((((((((((((({({({.({((..,.,{({((((({....,,,..{,{(({{.{{{{........{{,...........}}.,..,...}}}|,))}}.,|,|}},,||)}|||,,}},.}}},}..}}),)))||{{...,)))}....,,,,,.{(((({...)))))}.........,))))))))))).))).))..)))))))...)))))))).(((.(((((,...,))))).)))...))))))))))).((.(((((...........,,))))).)}..}}||.||||{{{{{,{,{{{..|{||,..,}}}.,,.)))))).))}|{{.,(((({{(((({(((.((({({{{...,,..|||}|.}||.}..}})))))))..)))|||{({{((((((,{{{.|{{|,,,,},,,,),)))),)))}}))))))),.))))).)))))).))))))))))))))).,)))))))..)).))))))))))).))).,|,....((((((..((((({......(((((({{(((((((((..............((((.((((((..(((..((.(((((,..({((.,......,))))..}.))))).))..))).)))))).))))...............)))))))))))))))}.....(({.,{..........}})))))))))..))))))....,,|{{,({(....(((((((((..(((((((..,.....,((({.........}}}}|(((((((((,{(((....)))))))}.........,....................(((((((((((,{{{.....},,}|((((,..{{{{{,.........,,.....{{,,,((((((((((..(((.(((((...,{{(((({,,,......}}.....,}}}}},..,,,},,.......|,.......|{.{({........},,},)))))...))).)))).))))))),....{{((((({.{{.....,)),))}})}))}}.})))))))))).|..........{(((...)))}..............))))),(((.((((((({{(((,{.,.||{{{{{...})}.,||{,((({,...},,...,||||....,.,.,,,,,.,}})))},.)))))))).))).{(({....})))..)).))))))).)))))))))...)))}},{((((...}}}},.........)))))...})}..........

Transcripts

ID Sequence Length GC content
NM_002122.5 NCBI
ACAAUUACUCUACAGCUCAGAACACCAACUGCUGAGGCUGCCUUGGGAA… 1574 nt 0.4581
Summary

HLA-DQA1 belongs to the HLA class II alpha chain paralogues. The class II molecule is a heterodimer consisting of an alpha (DQA) and a beta chain (DQB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells (APC: B Lymphocytes, dendritic cells, macrophages). The alpha chain is approximately 33-35 kDa. It is encoded by 5 exons; exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. Within the DQ molecule both the alpha chain and the beta chain contain the polymorphisms specifying the peptide binding specificities, resulting in up to four different molecules. Typing for these polymorphisms is routinely done for bone marrow transplantation. [provided by RefSeq, Jul 2008]

Forensic Context

A study in humans identified the HLA-DQA1 as a high-degree node in a protein-protein interaction network and a differentially expressed gene downregulated in the blood of myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580]. A separate study in mice and humans found the HLA-DQA1 upregulated in monocytes from septic mice and incorporated it into an eight-gene machine learning model that achieved high diagnostic accuracy (AUROC 0.904-0.924) for identifying sepsis in human blood samples [Li et al. DOI:10.1007/s00011-025-02068-7].