Basic Information

Symbol
HLA-DQA2
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DQ Alpha 2 HLA-DXA HLA Class II Histocompatibility Antigen, DQ(6) Alpha Chain HLA Class II Histocompatibility Antigen, DQ Alpha 2 Chain MHC Class II DQA2 DX Alpha Chain HLA Class II Histocompatibility Antigen, DQ Alpha 1 Chain MHC Class II Antigen MHC Class I Antigen MHC Class II DQA1 DC-1 Alpha Chain DC-Alpha DX-ALPHA HLA-DQA1 HLA-DCA HLADQA2 DQA1
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Sudden cardiac death diagnosis

MANE select

Transcript ID
NM_020056.5
Sequence length
1458.0 nt
GC content
0.4698

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-421.60 kcal/mol
Thermodynamic ensemble
Free energy: -448.13 kcal/mol
Frequency: 0.0000
Diversity: 283.66
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((...((((.(..(((((...)))))..)))))..((((((.........))))))....)))(((((((.(.(((((....))))).)..(((((..((((((((...((((((...(((((.((.....)).)))))))))))...)).(((((((......))).))))((((.....)))).......((((.......))))....((((.((((....((((((((((.......(((..((.((((((((.(((...((..((((((.....(((..(((((((((((.((((((((.((((((((((((.((((((((.(((((((((.....((((((((((((.....((((((((((((.....((((((..((((.(((((((.(............))))))))(((((.((((...((((((.((...(((((...)))))..............(((((....))))).((((((((.........))))))))..)).)))))).))))..)))))....(((..(((((.((....)).)))))..)))))))..)))))).....(((((((.(((..((((...))))....)))))).))))((.((((((((((((((.(((...........(((.((((((((.((..........)).)))).)))).)))((((....)))).......))).))))))..))))))))))))))..)))))))).)))))).)))))))))))))..)).)))...((((((((...)).))))))(((.((....))..))).(((((....(((.((((...)))).))).)))))..(((.((((((...(((((.......))))))))))))))(((((((.....(((((((((.((((.........(((....((((((..((..((((((((...((((((............((.((........))))...(((((....................)))))............................((((((...((((((.((......))))))))))))))...............((((..((.(((((.(((.((((......)))).))).))))).))..))))..))))))...))))))))..)).))))))...)))..)))).))).))....))))..)))))))............)))))))).)))))))))...(((.((...)).)))...........)))))))).))).......(((((....)))))))).))))).....))).......))))))...))....))).)))))))).))...)))..))))))).)))..)))))))).......))))))..)))))..)))))))....................
Thermodynamic Ensemble Prediction
.....{(((.,.((((.({{((((({..|}}}},.})})),.{(((((.........)))))}....,}}||||,,|}|,(((((....))))).,..(((((..((((((,{...((((((...(((((.((,....}).))))))))))).,,||.((({(({....,,)|}.}}}}(({(.....)))).,.....((((.......)))).|..((((.((((....((((((((((.......(,(..((.((((((((.(((...((..((((((.....(((,.(((((((,(((.((((((((.((((((((((((.(((((,{(.{,(((((((.....((((((((((((.,...,(((((((((((.....{(((((..((((.(((((((.(............,)))))))(((((.((((...((((((.{{..,((({,.,.}|||,,,...........,|{{|||..,}}}}}.{(((((((.........))))))))||)},)))))}.))))..)))))....(((..(((((.((....)).)))))..)))))))..))))))...,,{,,({{{.{((,.{{{{...,,,).,,.)))))).)))}{{.,(((({{((((,|{||{{{,(({{...,,..|||,|,||{....,})))))))..)))}|||((((((((({(({{{{(|....}},,,)))))).)))))))))})),,}))))..)))))))).))))))}}))))))))))))..}).}},...(((((({{...,}.))))))(((.((....))..))).(((((....(((.((((...)))).))).)))))..,{,{((((((...(((((.......))))))))))))}|(((((((.....{({{(((((.((((.......,.(((....((((((..((..((((((((...((((((......,,..,.{(,((........)),,...,..,,......,},...........|||,......,..,........|..........|||||,...(((((,,((......)))))))),,}}},....,,.........{(((,.((.(((((.(((.((((......)))).))).))))).)),,))},..))))))...))))))))..)).))))))...))).,)))).))).))....})))..))))))),...........)))))))).)))))))))...(((.{{...}}.))),|......,,.)))))))).))).......(((((....))))),)).))))).,...}}}.......)))))}...))....))).)))))))).))...)))..))))))).)))..)))))))).......))))))..)))))..,))))),....................

Transcripts

ID Sequence Length GC content
ACAAUUGCUCUACAGCUCAGAGCAGCAACUGCUGAGGCUGCCUUGGGAA… 1458 nt 0.4698
Summary

This gene belongs to the HLA class II alpha chain family. The encoded protein forms a heterodimer with a class II beta chain. It is located in intracellular vesicles and plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (B lymphocytes, dendritic cells, macrophages) and are used to present antigenic peptides on the cell surface to be recognized by CD4 T-cells. [provided by RefSeq, Jun 2010]

Forensic Context

A study in mice demonstrated that the HLA-DQA2 was upregulated in monocytes from septic mice compared to sham mice and was selected as a key gene for sepsis identification, ranking 7.4 in a final eight-gene machine learning model [Li et al. DOI:10.1007/s00011-025-02068-7]. In human sepsis patients, research identified the HLA-DQA2 as a ligand for the CD4 receptor, participating in the MHC-II signaling pathway, which is involved in cell communication between monocytes and other cells [Liu et al. DOI:10.1590/1414-431X2025e14930]. A study in humans identified the HLA-DQA2 as a high-degree node in a protein-protein interaction network and a differentially expressed gene downregulated in the blood of myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580].