| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACAAUUGCUCUACAGCUCAGAGCAGCAACUGCUGAGGCUGCCUUGGGAA… | 1458 nt | 0.4698 |
This gene belongs to the HLA class II alpha chain family. The encoded protein forms a heterodimer with a class II beta chain. It is located in intracellular vesicles and plays a central role in the peptide loading of MHC class II molecules by helping to release the CLIP molecule from the peptide binding site. Class II molecules are expressed in antigen presenting cells (B lymphocytes, dendritic cells, macrophages) and are used to present antigenic peptides on the cell surface to be recognized by CD4 T-cells. [provided by RefSeq, Jun 2010]
A study in mice demonstrated that the HLA-DQA2 was upregulated in monocytes from septic mice compared to sham mice and was selected as a key gene for sepsis identification, ranking 7.4 in a final eight-gene machine learning model [Li et al. DOI:10.1007/s00011-025-02068-7]. In human sepsis patients, research identified the HLA-DQA2 as a ligand for the CD4 receptor, participating in the MHC-II signaling pathway, which is involved in cell communication between monocytes and other cells [Liu et al. DOI:10.1590/1414-431X2025e14930]. A study in humans identified the HLA-DQA2 as a high-degree node in a protein-protein interaction network and a differentially expressed gene downregulated in the blood of myocardial infarction patients compared to healthy controls [Zhao et al. DOI:10.3892/etm.2017.5580].