| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUUCUUGUCUGUUCUGCCUCACUCCCGAGCUCUACUGACUCCCAACAGA… | 1235 nt | 0.4769 |
HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. This molecule is expressed on the surface of various antigen presenting cells such as B lymphocytes, dendritic cells, and monocytes/macrophages, and plays a central role in the immune system and response by presenting peptides derived from extracellular proteins, in particular, pathogen-derived peptides to T cells. The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq, Aug 2020] CIViC Summary for HLA-DRA Gene
A study in humans identified HLA-DRA as a significantly upregulated diagnostic biomarker in sepsis patients compared to healthy controls, with expression localized to myeloid cell clusters [Li et al. DOI:10.3389/fimmu.2025.1700704]. In a separate human skin wound healing atlas, HLA-DRA was utilized as an MHC class II marker for myeloid cell identification and was expressed in myeloid cell clusters within wound-edge tissues [Liu et al. DOI:10.1016/j.stem.2024.11.013].