Basic Information

Symbol
HLA-DRA
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DR Alpha HLA-DRA1 HLA Class II Histocompatibility Antigen, DR Alpha Chain MHC Class II Antigen DRA Histocompatibility Antigen HLA-DR Alpha
Location (GRCh38)
Forensic tag(s)
Cause of death analysis Wound age identification

MANE select

Transcript ID
NM_019111.5
Sequence length
1235.0 nt
GC content
0.4769

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-361.30 kcal/mol
Thermodynamic ensemble
Free energy: -384.96 kcal/mol
Frequency: 0.0000
Diversity: 387.39
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......(((.((...((.((......))))...)).)))...........(((((((((..(((((((....((((((((.......((((.(((.....))).)))).(((((....)))))...((((((((..((((((((((..(((((((...((...........((((.....))))(((((....))))).))...)))))))..)))))))))).))))....))))..((((((((((...((((((((((((...(.(((((.(((((...(((((((((..........(((((.....((((((((((((........((((((...(((...(((((...(((.......((..............)).......)))....))))).)))..((((........))))..(((((((((.(((((.((.....)).))).)).)))))))))....))))))........))))))))).)))((((((......((((((((((((....)))))..((((...))))((((((((.....))))))))...(((((((..(((...(((((((.((((..(((((((((....))))............)))))(.((((....((((((((((...((.((((((((.....))))))...)).)))))))))))))))))....(((((.......)))))((((((((.((((((..(((((..((((((((...(((....)))..)))).............(.(((((......))))).)..)))).))))).))))))..)...))))))))).)).)))))))...))).).))))))....(((((((.....(((((((...(((((....)))))(((((...........))).))......)))))))...)))))))..))))))).......)))))).(((....)))....)))))...))))).))))...)))....)).))))).)....))))))....)))))).))))))))))....))))))))....))))))).(((((((((.((...))...)))(((((...(((((((((..((((((....((((......)))))))))).)))))))))..)))))((((.(((...))).))))((((.(((....)))))))...........)))))))))))))))...
Thermodynamic Ensemble Prediction
......{((.((...(,,((......)))}...}}.)))........,,.(((((((((..((((((({{{{,{((((((.{({{{,((((.(((.....))).)))).(((((....))))).,{(({{{(((,{{(((((((((..(((((((...((...{{{{....{{{{...,.)}}}||||,....}}})).)}...)))))))..)))))))))),||||,,..,}}}..((((((((((...((((((((((((...(,(((((.{{(((..,((({.{..((((((((((((((((((.{((((({((({{{,.{,..,.|||||.},,,||,..,,|({{...,........,.,.}}}......,{.,{.,{{{||,||||,||{,(({((({..((((........)))).|((((({{{{,(((((.{(,,,..}}.}}}.||,||}}})))),...},,,..((((((((,{,{{{..{{{|,{|||{{{{.....,}}}..,,,|}}}}.,}|{{{.((((...)))),||}|,..((((((((.{.(((((.(((((,,{{(((((((....((((...{(((((((((....))))..{,....},,.)))))).))))...)))))))))|,,{{{,.,,,{||||,{{.(((((((,,,{..|||.}})))...})))))).).}}...))))).))))).}...)))))))).})))..))).}))))))))...,,...,})}}.,,.}}},,.........(.(((((......))))).).,|.,..,))}}})})))))||,,|||,,|||.,,|||}}}||.||{{{((((,((,,,,.||.}},,,))}}),))}})))),)))))))},))))))))))))........,,.{{{....}}),}}.(((((((.......((((..((((,{......,,,,,.....),})))).))))......))))))),}}...))),,..)),))))).),...))))))....)))))).))))))))))....,,.,}}}},...,},||,|,{,,,,,|||,|,...}},,.}))}|||,...{{|||||{{..,|,|}}}}}}||||.,{{{{|,,.,)))))},,,||||||.,{|{|.((((.{((...})).))))||||},,.....),))))),....})}))))..,..)))))))))...

Transcripts

ID Sequence Length GC content
AUUCUUGUCUGUUCUGCCUCACUCCCGAGCUCUACUGACUCCCAACAGA… 1235 nt 0.4769
Summary

HLA-DRA is one of the HLA class II alpha chain paralogues. This class II molecule is a heterodimer consisting of an alpha and a beta chain, both anchored in the membrane. This molecule is expressed on the surface of various antigen presenting cells such as B lymphocytes, dendritic cells, and monocytes/macrophages, and plays a central role in the immune system and response by presenting peptides derived from extracellular proteins, in particular, pathogen-derived peptides to T cells. The alpha chain is approximately 33-35 kDa and its gene contains 5 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, and exon 4 encodes the transmembrane domain and the cytoplasmic tail. DRA does not have polymorphisms in the peptide binding part and acts as the sole alpha chain for DRB1, DRB3, DRB4 and DRB5. [provided by RefSeq, Aug 2020] CIViC Summary for HLA-DRA Gene

Forensic Context

A study in humans identified HLA-DRA as a significantly upregulated diagnostic biomarker in sepsis patients compared to healthy controls, with expression localized to myeloid cell clusters [Li et al. DOI:10.3389/fimmu.2025.1700704]. In a separate human skin wound healing atlas, HLA-DRA was utilized as an MHC class II marker for myeloid cell identification and was expressed in myeloid cell clusters within wound-edge tissues [Liu et al. DOI:10.1016/j.stem.2024.11.013].