Basic Information

Symbol
HLA-DRB1
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DR Beta 1 HLA-DR1B Major Histocompatibility Complex, Class II, DR Beta 1 Precursor HLA Class II Histocompatibility Antigen, DR-1 Beta Chain HLA Class II Histocompatibility Antigen, DRB1 Beta Chain MHC Class II HLA-DR Beta 1 Chain Human Leucocyte Antigen DRB1 Human Leukocyte Antigen DRB1 Lymphocyte Antigen DRB1 HLA-DRB DRB1 SS1
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002124.4
Sequence length
1223.0 nt
GC content
0.5511

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-454.30 kcal/mol
Thermodynamic ensemble
Free energy: -477.07 kcal/mol
Frequency: 0.0000
Diversity: 344.37
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
......((((............))))..((((((((((((..(((((........((.((((.((((((.(((.....))).((..(((((((((.(..((((..((((..(((((.(((((.(....(.(((((((......(((((((..((((...))))..))))))).....((((((.((((((((((((....)))).(((((.....)))))...((...((((((((...))))))))...)))))))))).)))).))..(((((..(((....)))....)))))))))))))..).))))))))).)..))))..))))..).)))))).))))).((((((((((((....((.((((...(((..(((((.((((.(((.(((((.(((((((((((((((((((....)))))))............((((((((((...(((.......((((.(((..(((......((((...........))))....)))...))).))))))).))))))))))..))))))).(((((..(((.......)))((((.((((..((((......((((((......)))))).....))))..)))).)))))))))))))).))))).)))(((((((((...)))))......((.(((((((.....(((((......(((..((((....)))).)))...)))))..)).))))).))((((((((((...((((((.((((((((.((((((.....(((((((((....(.((((......)))).))))))))))))))))))))))))..((((((.(((..((((.(((..(((........))).((.((.((((.(.((((((...((((...)))).)))))).).)))))).))........))).))))..)))))))))(((..((((((..........))))))..)))........))))))..))))))))))))))((((((((((((((........))))))..))).....))))).)))).))))))))...))))..))....))))....))))))))......))))).).))))))........)))))..))))))))))))....((((((....))))))...........((.(.(.(((.(((((..(((......))).))))).))).).).)).
Thermodynamic Ensemble Prediction
.......{((..,{........))|,.,((((((((((((..(((((.......,(({((((.{(((((,,(({(.((((({(({{(({(((((({(,,((((,,((((..{((((,({(((.,,,{{(,,{(((({,{....(((((((,.((((...)))).,))))))).||,{({((((.(((((((({(((....)))|.(((((.....})))),..((...((((((({...))))))))...)))))))))).)))).)).{(((((..(((....)))....)))))))))))))}.},)))))))))}),.)))).,)))),,}.)))))).))))).))))))((((((((.((((..{{.(,(((....((....))...})).},.}}.))))))))))))((((((.(((.(((((((({,..((((.((((((((((...((,......{((((.(((,.(((......((((...........))))....))).,.))).))))))).)))))))))).)))).)).))))).)))))).))))))||||}|,{,{{,...{||||,,.,.)))),..}))))))))},..((((((((((...)))).)}}})))..|((({...{{...(((({...})))).}})))),((((((((.....((((((.((((((((,{{{...{{{(((((((((.(((((((((,,(({,,{{((((((((((.((......}}}}}||,,..,,((({..((.(((..(((,...})))..))).))))))}))))))))))))))..))))))..))))),,.}))).)))}}.))))))))))))))((((........))))((((((((((({((((,...{{((({{({...{|.|{{{....,,,},..{((((((.,..(((((........((((((..........))))))..)))))...)))))))(((((.(((((({((((((({,,(,(({,,{,,,,}}}},}},..))).))))}..)))))).)))))})}.,,}))))}))}}).,.))))}}))))))))))))))),..))))}.),))))}}.,,,....)))))..)))))))))))}....((((((....))))))....,,........,,,.{{{.{{{{{.,||{,,,.....},)))}}.}}}.,,}.)),

Transcripts

ID Sequence Length GC content
AGUAACUUCCUCCCUAUAACUUGGAAUGUGGGUGGAGGGGUUCAUAGUU… 1223 nt 0.5511
Summary

HLA-DR B1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and some alleles have increased frequencies associated with certain diseases or conditions. For example, DRB1*1302 has been related to acute and chronic hepatitis B virus persistence. There are multiple pseudogenes of this gene. [provided by RefSeq, Jul 2020]

Forensic Context

A study in humans demonstrated that the HLA-DRB1 was downregulated at 24 and 48 hours after ICU admission in severely injured patients compared to healthy controls [Galbraith et al. DOI:10.1016/j.surg.2018.05.042].