Basic Information

Symbol
HLA-DRB3
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DR Beta 3 HLA Class II Histocompatibility Antigen, DR Beta 3 Chain MHC Class II Antigen DRB3 Major Histocompatibility Complex, Class II, DRB3 MHC Class II Antigen DR Beta 3 Chain MHC Class II HLA-DR Beta 3 Chain Human Leucocyte Antigen DRB3 MHC Class II DR Beta Chain MHC Class II Protein HLA-DRB3* HLA-DPB1 HLA-DR1B HLA-DR3B HLA DRB3 DRB3
Location (GRCh38)
6:3715352-3728489
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Chronological age estimation Mechanical injury analysis Cause of death analysis
External database
HGNC NCBI OMIM UniProt

MANE select

Transcript ID
NM_022555.4
Sequence length
1228.0 nt
GC content
0.5521

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-462.90 kcal/mol
Thermodynamic ensemble
Free energy: -482.37 kcal/mol
Frequency: 0.0000
Diversity: 414.36
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
..(((((((.((((........))((((((..((.(((((((.......)))))))...(.(((((((((.(((((...(((...(((((.(((((((.(((((((...((.((.......)).)))))))))....(((((((((.(((...((((...))))))).))))))))).......(((....))))))))))...))))).)))....))))).).)))))))).)((.(((((.....))))).))((.(((((((.(((((.((.((((...(((((.......))))).(((.(((((...)).))).)))..((((((((((.((((((.(((((((((((((((((.....)))((.(((((((((((((....(((((.(((((....((.((...((((((((((.((((((((((((((..((((.(((((((((((.....))))..(((((.(((..(((......((((..((...))..))))....)))...))).)))))......))))))).)))).)).))))).)))))))))))))).))).)).))....))))).))))).....(((((((((((((.(((((.(((((...(((((.(((....((((...))))...(((((((((((..((..((...((.......))...))..))..)))).))))))).....)))..))))).))))).(((((.....)))))(((.((......)))))((((((((((....((.(((..((((...))))..))).))....)))))..))))).))))).))))))))...)))))))))))))........))))).))........((.((((.((((((((...((((...)))).)))))))).)))))).........(((((...))))))))))))))))).(((((((..((((.........)))).))))))).(((((((.((((((((((((((((.(((((....))))).)).....))).)))))..)))))).)))))))..........))))))))..((((((..(((........)))..))).)))...............))))))))))..(((..........)))...)))).))...)))))))))).)).)).))..))))))(((((....)))))........)).)))))))..
Thermodynamic Ensemble Prediction
..(((((((.((((........)){(((((((((,{((((((((((((.{{{{,,,|||.,{{{((((((.(((((...(((.,,(((((.((((({{.{((((((...((.((.,.....}}.}}}))))}|,,{,{(((({(({.(((,,,{(((,,,|||}}}}.|||}}||||,,.|,,,(({....}}}|||}}}},,,))))).))}....))))),}.)))})))}.}|||||}||.,.}}}}})}}}}||}||{||,||,,,.||{|{|,,|,..,.}}}},..||||||||.,,{||{.(({.{{|...,))}.}}|{||||((,({(((((({(((((,((((,,,||||}}}}})))|..,|||||,||{|{|,,..||,||.|||||,||,|,.|||,,((((((((((.((((((((((((,,..{{{{.(((((((((({,.,.,}}}}.,(((((.((({,(({......{{|{,,||,.,))..))))....})).},))),))))||,,,,,}}}))}).)))),)),))))).)))))))))))))).))).}}.||{{{{|,|||{||..,{{{..(((((((((((((.(((((.(((((.,.(((((.(((..{.{(({...,}}}..,{((((((((((..((..((...{(,,.....}),,,))..))..))))}}))))}}..,..)))..))))).))))).{((((.....))))|(((.((......)))))|(((((((((....((.(((..((({...})))..))).))....))))).,))))).))))).))))))))...))))),,))),))}}}}}}}})))},.,},},.,|},||,|{{(,((((((((,,,((((,..,|||,|}}||||},||||.|,...,{,..,{||,..}),))))),,|||||,,|{,(((.{,....,,.}}}.})..))))}........(((((((.(((((({((((({(((,(,(((....))))),},.,,..))).)))))..)))))).)))))))}}}}}}))).))))),,,,}||||||}}|||,..,....|}}{{}||.)))...............)))))))))},))),......)))))))))}}}((({....)))).,,}}},,)})),,...)))}}}(((((....)))))........)).)))))))..

Transcripts

ID Sequence Length GC content
NM_022555.4 NCBI
AGUAACUUCCUCCCUAUAAUUUGGAAUGUGGGUGGAGGGGGGUCAUAGU… 1228 nt 0.5521
Summary

HLA-DRB3 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020]

Forensic Context

A study in humans identified a 125-gene transcriptomic signature from T lymphocytes of monozygotic twins, enabling chronological age estimation with a Pearson’s R=0.93 in validation, and the HLA-DRB3 was a top-ranking gene in this signature with a strongly positive ridge coefficient, consistent with a known increase of HLA-DR expressing T cells with age [Remondini et al. DOI:10.1038/s41598-017-05694-2]. In a separate investigation of human traumatic brain injury, the HLA-DRB3 was identified as one of the four most significantly down-regulated mRNAs in brain contusion tissue compared to adjacent control tissue [Yang et al. DOI:10.4103/1673-5374.247467]. A study in humans demonstrated that the HLA-DRB3 was significantly reduced in CHIT1+ neutrophils from sepsis non-survivors compared to other myeloid cells [Li et al. DOI:10.1038/s41598-025-99619-z]. Another human study identified the HLA-DRB3 as part of the MHC-II signaling pathway, where it binds to CD4 and is involved in monocyte-related cell communication, with its expression down-regulated in sepsis non-survivors [Liu et al. DOI:10.1590/1414-431X2025e14930].