Basic Information

Symbol
HLA-DRB5
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class II, DR Beta 5 MHC Class II Antigen DRB5 DR Beta-5 HLA Class II Histocompatibility Antigen, DR-5 Beta Chain HLA Class II Histocompatibility Antigen, DR Beta 5 Chain DR2-Beta-2 HLA-DRB5* DRB5 Dw2
Location (GRCh38)
6:32517345-32530369
UCSC Genome Browser Search in Marker Scope
Forensic tag(s)
Sudden cardiac death diagnosis Cause of death analysis Sudden death from CNS diseases
External database
HGNC NCBI Ensembl OMIM UniProt GTEx

MANE select

Transcript ID
NM_002125.4
Sequence length
1250.0 nt
GC content
0.5408

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-431.60 kcal/mol
Thermodynamic ensemble
Free energy: -457.54 kcal/mol
Frequency: 0.0000
Diversity: 356.44
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((.(((((((((.((....((.(.(((((((((...(((.(((.((((((((...((((.((.(((((..(((.(((....))).)))..))))).))..))))..(((((((((.(((.(...(((((.......)))))(((.((((....)))).)))....(((((...)))))..).))).))))))))).....))))))))))).)))((((((...))))))(((....)))....)).))))))).)...))((((((......(((.((((((((((.(((.(((((.(((((((((((((((....((.((((...(((..(((((.((((....((((.....))))(((...)))(((((((....(((((((........(((((((.(.(((((.(((((((.((((((((.......)))..(((.(..((((....(((((.((........)))))))...))))..).))).).)))).)))))))..........((((((((..(((((((.((((((.(((((.....((((((((((.((((((((((((...))))...)))((((((((.((....(((((...)))))...((.((.(((((((.....(((((......(((..((((....)))).)))...)))))..)).))))).)).))..(((((.((......)))))))..)).)))))))).(((((((((....(.((((......)))).))))))))))..))))).))))))).)))..)))))....)))))))))))))......(((.(((((.((((.((((((.(..((.......))..).)))))).)))))).)).).)))..((((.(......).))))((((((.........))))))...)))))))).((((.(((((....)))))))))))))).).)))))))((((((........)))))))))))))....))))))))))).))))))))...))))..))....))))....))))))((((((....))))))..................)))))...)))))...)))...((....))........)))))))))))))((((.......))))..................)))))).((((...........)))).....)).)))).............................))))).)))))
Thermodynamic Ensemble Prediction
.{((((.((((({{((...,}}},,.{.(((((((((..,(((.(((.((((((((...((((.((.(((((..(((.(((....))).)))..))))).))..))))..(((((((((.((({(,,,{.{,({{{{,..|||..,|)}||||}}..}},,,))|,...(((((...)))))...,))).))))))))).....))))))))))).)))((((((...))))))(((....)))....)),})))))).}...|{(({.....})))|||.((((((((((.(((({{((..(((((((.(((((((((.,,{,,,|,.({((....,||}}.{{{..,,||||.....))))).))))(((((((....))))))),,..........(((((((((((({,,(((((((.(((({(((.......)))..(((,{..((((....(((({,((........))))))).,.)))),,).)}}.).)))).))))))},|{,......}}|((.(((((((((((,(((,(({{..(({,.{((((((,((,(((((((.((((((.(((((.(((((((((((.,,..((,{.(((({...})))).}}|,,{,,{.((((,...)})}|||,,{{{{((({,((({....,|||.(({{{.{(((({{((,,((||.|,{(((((((((.((......))))))}..,..|||{{..((.(((..(((,...})))..))).))))))})))))})))))))),.))))))..))))).}}}))}.,.,}).))))))))..))})),,...|})).)}.})))).|)})}}..,.....{{{|{{(({|,,|,{||||||.,|.,..,,..(({{...,,.}})}))})|||||,.|}}}}.,..,))))}}})),))))))},........(((((((.(((((({(((((((,....{((((((........)))))))))).))))}..)))).))))))))),})))..})))))}}||...}}},(({{(,....((((((....)))))).....))}}}})))))))))),),.,))))).)))))}.))),,))))}))).}).))))))))))|{{((((.......)))).}},,,,,,...,{({({({.((((((({{..........}))).......)))).,,.})}..,,.,,,,..............))))).))))}

Transcripts

ID Sequence Length GC content
NM_002125.4 NCBI
AUAGUUCUCCCUGAGUGAGACUUGCCUGCUCCUCUGGCCCCUGGUCCUG… 1250 nt 0.5408
Summary

HLA-DRB5 belongs to the HLA class II beta chain paralogues. This class II molecule is a heterodimer consisting of an alpha (DRA) and a beta (DRB) chain, both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa and its gene contains 6 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the two extracellular domains, exon 4 encodes the transmembrane domain and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Typing for these polymorphisms is routinely done for bone marrow and kidney transplantation. There are multiple pseudogenes of this gene. [provided by RefSeq, Feb 2020]

Forensic Context

A study in humans demonstrated that the deletion allele of a 5-bp indel polymorphism (rs3036297) in the 3' UTR of HSPA1B, which is involved in a long-range cis-regulatory interaction, was significantly associated with a higher risk of sudden cardiac death (SCD) and correlated with increased expression of the HLA-DRB5 gene in cardiac tissues [Yang et al. DOI:10.1016/J.Forsciint.2020.110637]. In a separate study utilizing mouse models and human data, the HLA-DRB5 was identified as a key upregulated gene in septic monocytes and was incorporated into an 8-gene machine learning model that achieved high diagnostic accuracy for sepsis identification, with AUROC values of 0.904 and 0.924 in independent test datasets [Li et al. DOI:10.1007/s00011-025-02068-7]. In a separate investigation of traumatic brain injury in mice, the HLA-DRB5 was identified as a characteristic gene of a 'Resolution Phase' macrophage subcluster in the meninges and was also found to be an activation marker for B cells [Bolte et al. DOI:10.7554/eLife.81154].