Basic Information

Symbol
HLA-E
RNA class
mRNA
Alias
Major Histocompatibility Complex, Class I, E HLA Class I Histocompatibility Antigen, Alpha Chain E MHC Class I Antigen E HLA-6.2 Non-Classical MHC Class I Antigen Nonclassical MHC Class I Antigen MHC Class Ib Antigen HLAE QA1
Location (GRCh38)
Forensic tag(s)
Sudden death from CNS diseases

MANE select

Transcript ID
NM_005516.6
Sequence length
2548.0 nt
GC content
0.5506

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-955.80 kcal/mol
Thermodynamic ensemble
Free energy: -1000.26 kcal/mol
Frequency: 0.0000
Diversity: 651.18
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((..((((...((((((....(((.((.((..((((((((((.((((....))))((((..((((............))))))))..(((((...(((.((.((((....((((((((((.((((((((((.(((((.((((((((((((((.((.(.(((.(((((.(..(((((.(((((((.((.(((....))).)))))))).).).)).))..))))))))).))).))))))))).))...((((((((...((((...(((((.((((((((((.(((..(.((((.(((....((((((.....)).))))..))).))))......((.((((.(.((((((((((.....)))).(((((.(.....).)))))((((((..(((((.((((.......))))))))).....))))))(((......)))..))....)))).).)))).)).)..)))))))))((((.((((.((....)).)))).))))..(((((.(((...(((.......(((((((..((...))..))))).))..........)))...))).))))).(((((((......(((.....))).((((.((...)).))))...)))))))............)))).))).))..)))).))))))))....)))..)))))..).))))))))..(((......))).((((.(((((((((..((((....))))((((......))))..((((((((((((..(((.((((((((((((.(((((((((((..(((((((((...(((((.(......).))))))))))).))).............((.((((.(.(((..(((.(((((.....))))).)))..)))).))))..)).((((....))))..))))))))...(((.....)))))).))))))).))))).))).))))).))).)))))).))))))).)))).).))))))))))..)))).))))))))))))))))))))((((.......))))((((((((((...((((..(((((((((.((((((..((((...)))).)))))).(((((((((((.(((((((.((.(((((((((((((((((.(......))))))))....(((((((..(((((((.......)))))))....((((.((((....((..((((....((((.(((((((((((.(((((((.((.((((((((((((((...((((.......)))).))))))..........))))))))((((((((((.((...((((.(((.((((((((..............(((((.....(((((((.....)))).)))..)))))....))))))))..))).))))..)).))).)))))))................))))))))).)).....((((((((((...................((((((((.(((.((((....)))).).))))))))))....)))))))).))...((((.((((((..((((...((((((((..((((((..((((....)).)).)))))))))).))))........))))...)))))))))).............(((((((((((...(((.......)))...))).))))))))..((((.((.((((..(((.(((....))))))...)))).)).)))))))))))))))))............(((((....(((((((.(((((.(((((((((((((((((....((((((((((((((((.......((((((..(((((((....(((((....)))))....))))))).))))))...((((((((..((............))..))))).)))((((((.((((((...(((........)))..)))))).))))))........)))))..))))).))))))......))))))))).))))..........)))).))))).)).)..)))))))))...)))).))....))))))))((((((..(((...))).))))))..))))))).))))))).......(((((((((....(((.....((((...))))....)))(((((.((((((...((((((.((((...((((((........(((((..((((.((..........)))))).))))).(((.((.....)))))....((((...((...((((....))))))..)))).....((((((.....)))))).))))))....))))))))))....)).)))).))))))))))))))......))))))))).))).))))))))))).......((...((((((....))))))...))(((.......)))....)).))))))).....)))).)))))))))))).))))).)))))).)))))))))).......................(((.......)))....
Thermodynamic Ensemble Prediction
((((({.,(((({{.((((((....((({(({((..((((((((((.((((....)))){{{{.,((((...{{{,....,))),))))}.(((({...((,{((.((((....((((((((((.(((({(((((,((({{.{(((((((((((((.{{.(,(((.(((((.(,.(((((.(((((((.((.(((....))).)))))))).).}.)).)).}})))))))).))).))))))))).)).,,((((((((.,,{(((...(((((.((((((((({{(((..{.((((.(((,,,,{{{{,{.,,,,)),)))}..))),))||,,....{,.{(({.{,({((({((((,,{..}||}{(({,|.,.}}},,})})}}|||||{|,(((({.{(({|,,.,{{||}}}||||..{,.,|||||(((......)))..))}},.})}},)}))),.,)})},)))))))))((((.((((.((....)).)))).))))..(((((.(((...(((.......(((((((..((...))..))))).))......,...)))...))).))))).(((((((.......,||,.,.|||{({{(.{{...)).)))).}})))))))............)))).))).)).,))}),))))))))..,.|||,.}||||.||,}}}}||||,{{{,,{{{{.,||{(({,{(,(((,,.|}},||,...})))).|||}}}}},))}},,((((((((((((..{((.((((((((((((.(({((((((((..(((((((((,..{((((.(......).))))))))))),})).............{{.((((.(.(((..(((.(((((.....))))).)))..)))).))))..}}.((({....})))..))))))))...|{{{,,..},,))).)))))))}})))).))).)))))}})).)))),}})))))))}}}))}).))))))))))..)))).)))))))))))))))))))),,||}.}}},,||,}((((((((((...((((..((((((({(.((((((..((({...}))).)))))).{{{{{{{{{((,(({{{{{.{,,|||||((((((((((({{(,,{{{.||,|||||....(((((({..(((((((.......)))))))....(((,{((((.,.,((.,((((,.,,({{{.((((((((({({(((((((.{{.((((((((((((((...((((.......)))).))))))..........))))))))((((((((((.(({(.((((,(((,{{((({{,......,..||},.,{((({{{{{({{{{{,,},,.)))),}},.{|||,,....,}))))})..))),)))).})}.))).})))))){,{,,......,,}},})))))))).)).}...((((((((((...................((((((((.{{(.((((....)))).).)}))))))))....)))))))).))...(((,,((((((..((((,..((((((((..((((((..((((....)).)).)))))))))).))))......,.))))...)))))))))).............((((((((,((...(((.......)))...))).})))))))..{(((.((.((((..(((.(((....)))))}...)))).)).)))}}))))))))}}}}...||,.,,.,{(({({....,,,||((.(((((.{((((((((((((((((....((((((((((((((((.,.....((((((..(((((((....(((((....)))))....))))))).))))))..,(((,{{||}}........,,.,,,)})},,,...{({((((((.((((((,,.(((........))).,)))))).))))))}}...,,})))))..)))))}})))))......))))))))).))))..........)))).))))).)).}..|||.||}}}...))}),)}....})))))))((((((,,{{{...))).))))))..,)))))).}}}}}}).....,.(((((((((....(((....,((({...}}}}}}},)))(((((.((((((...((((({{((((...((((((.{{{{{..(((((..(((,,((..{....,..)))))).))))),(({.((..,.,||}}|{,..,|||...||,..{{{{....))))))..,}},.....((((((.....)))))).))))))....))))))))))....)).)))).))))))))))))))....,,))))))))).))).))})))))))).......|{...((((((....))))))...,,{({.......}}}....)}.))))))).....)))).)))))))))),)}))))).)))))).))},)))))).....,,.....,,.........{{{...,,,.)))....

Transcripts

ID Sequence Length GC content
CUCAGGACUCAGAGGCUGGGAUCAUGGUAGAUGGAACCCUCCUUUUACU… 2548 nt 0.5506
Summary

HLA-E belongs to the HLA class I heavy chain paralogues. This class I molecule is a heterodimer consisting of a heavy chain and a light chain (beta-2 microglobulin). The heavy chain is anchored in the membrane. HLA-E binds a restricted subset of peptides derived from the leader peptides of other class I molecules. The heavy chain is approximately 45 kDa and its gene contains 8 exons. Exon one encodes the leader peptide, exons 2 and 3 encode the alpha1 and alpha2 domains, which both bind the peptide, exon 4 encodes the alpha3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. [provided by RefSeq, Jul 2008]

Forensic Context

A study in human post-mortem brain tissue demonstrated that the HLA-E was specifically up-regulated in chronic traumatic encephalopathy (CTE) compared to normal controls, as part of a cell adhesion molecules (CAMs) pathway alteration unique to CTE pathology [Cho et al. DOI:10.1038/s41598-020-65916-y].