| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUAAGCUCCCCUGAGCCGGUGCUGCGCUCCUCUAAUUGGGACUCC… | 1773 nt | 0.6041 | |
| GGUCCCCAGCAGCAAGAGGUGGGGGGAGGCACCAGAUGGUAUGAGAGCU… | 1849 nt | 0.6068 |
This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes. [provided by RefSeq, Jan 2016]
A study in humans demonstrated that the HMGA1 was hypermethylated and upregulated in the prefrontal cortex of individuals who died by suicide compared to sudden death controls, and it was enriched in pathways related to inflammation regulated by macrophage migration inhibitory factor and chromatin modification [Romero-Pimentel et al. DOI:10.1093/ijnp/pyab042]. Another study in humans found that the HMGA1 was downregulated as part of the inhibited base excision repair pathway in the lungs of patients who succumbed to septic shock [Pinheiro da Silva et al. DOI:10.1111/jcmm.17938].