| ID | Sequence | Length | GC content |
|---|---|---|---|
| AUAAAGUCCUGCCGGGCACCACUGGGCAUCUCUUUCAAGGUUUCUGCUG… | 2351 nt | 0.4904 | |
| AUCUCUUUCAAGGUUUCUGCUGGGUUUCUGAACUGCUGGGUUUCUGCUU… | 2433 nt | 0.4986 |
The protein encoded by this gene belongs to the HMG-CoA synthase family. It is a mitochondrial enzyme that catalyzes the first reaction of ketogenesis, a metabolic pathway that provides lipid-derived energy for various organs during times of carbohydrate deprivation, such as fasting. Mutations in this gene are associated with HMG-CoA synthase deficiency. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2 009]
A study in mice demonstrated that the HMGCS2 was commonly down-regulated in liver tissue following in vivo irradiation of Kupffer and endothelial cells with α-particles, showing less than half the expression compared to non-irradiated controls [Roudkenar et al. DOI:10.1269/jrr.07078]. In a separate human study, the HMGCS2 was identified as a down-regulated gene expression marker in heart tissue from patients with various structural heart diseases, with a mean fold change of 0.5035 and an adjusted p-value of 2.9399 × 10^-08, contributing to a 62-gene signature that achieved approximately 95% classification accuracy [Fajarda et al. DOI:10.1186/s13040-020-00217-8].