Basic Information

Symbol
HMGN2
RNA class
mRNA
Alias
High Mobility Group Nucleosomal Binding Domain 2 HMG17 High Mobility Group Nucleosome-Binding Domain-Containing Protein 2 High-Mobility Group (Nonhistone Chromosomal) Protein 17 Non-Histone Chromosomal Protein HMG-17 High-Mobility Group Nucleosomal Binding Domain 2 Nonhistone Chromosomal Protein HMG-17 High Mobility Group Protein N2
Location (GRCh38)
Forensic tag(s)
Drug abuse diagnoses

MANE select

Transcript ID
NM_005517.4
Sequence length
1940.0 nt
GC content
0.4407

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-581.50 kcal/mol
Thermodynamic ensemble
Free energy: -617.13 kcal/mol
Frequency: 0.0000
Diversity: 618.49
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.....(((((((((..((((((((((.((....((((.......(((((((.....(.(((...))).)...)))))))....)))).....)).))))))))))......((..(((...))).))......(((((..(((((..((....((.((...((..((.((..((.(((.........)))))..))))..))...)).)).....))..)))))..)))))...((((((((((...((.(.((((.(((((....(((((..((((..((((((((((...((((....))))((((.......))))...((((((((....(((((((...(((.((((((((.(((((..(.((((......)))).).((((((((...((((...........))))(((((..((((((((((((((((((...((((((((((((((((...........)))))).(((((((.(((.((((..(((((.......)))))...((((((.((((((...((((..............))))...))))))))))))...)))))))))).)))))))))))))).........((((((((((((((((((((..........(((((((((((((((..((.(((.......)))...))...)))))))))).)))))..((((((((...))))))))((((...)))).....)))))......(((((...(((......)))..))))).....((((((....))))))))))))).))))))))....)))).))))))))...(((((.....)))))....((((((((....((((((((.....))))..))))..))).)))))..((((((((((......((((..(((((((...((((....))))......)))))))..))))))))))))))....)))))).....))))))))))))).(((((.....)))))))))).))))))))((((...((((.......((((.....)))).......))))..)))))))....))))))).(((((.(((..(.(((.((((..(((((.......)))))(((((((..(((.(((....)))..)))..))))))).....((((((((........))))))))))))...))).)..))))))))...((((((....))))))...))))))))....((((((....)))))).((..((((((((((............((((....))))((((((.......((((((...))))))(((((((((.(((......))))))).)).))).((((((.....(((....)))((((((...)))))).........(((.((..(((((((..(.((.((((...))))..)).)..)))))))...)))))..)))))).((((((((((....))))))))))))))))))))))))))..))...((((((.....))).)))....(((((((...)))))))....((((((((.....)))))))))))))))))).)).))..).)))).((((((((((.....((((.((((((................))))))...)))).....)).)))))).))..(((((........))))).((((.(((((.....))))))))).((((((....)))))).((.(((((((((..(((.(((.....))).))).)))).))))).))..))))).)))).).)))))))))..)))(((((((.....))))))).........)))))))))...(((((....)))))...(((.((((((((((......((((.(((......))).))))...)))))))))).))).....
Thermodynamic Ensemble Prediction
....{(((((((((((((((((((((.((....((((.......(((((((.....,.(((...))).)..,)))))))....)))).....)).))))))))))......((..(((...})).}}......(((((..(((((,..((((...({{(((.((.,,(((.................))).}..)).)))))...))))..,.......)))))..)))))...{,{.,,(((({{{(({(,((((.{{{,,..,}}||(((({{,,..,{{{{||||{...((((....))))((((.......))))......,,..{||...|||...,{{{({.{((({,,({(({{{..(.((((......)))).).....,{(({{{{{{,...,{,{,{{,{{||{{{,,,{(|{,{,|||}||{{{{||,,.(((((((((({(((((,{{{,,.{{{,||||||.((,,,,|,,,|}||||,.,(({{.......}}},,.,,||||,,.||||||}}}|{{,....,,....,...,,,,,,.,....))))||{{...,,,)))),}.}}}})))))))))),.,}},,,.((((((((((((((,{((((..........(((((((((((((((..{,.{,({.,....,,}.,}}},..)))))))))).))))).{((((((((...))))))))|(((...)))).....))))}......(((((...(((......)))..)))))....,((((((....))))))))))})),))))))))}}))))}},})))))}},}.|||.,,||||}}.,{|||.((((((((.,,.((((((((.....))))..)))),,))).))))).((((..(((((...})))).,.}}}),{{(((((((.((({{({....,,,)),.))).))))))).}},,}}}|}}}}}}|(((,,..,||||||||{{|{{((({{,.,(((((...)))))|{{(({{.(({{...((((.......{(((.....)))),...,,.))))..}}}|{{{,{((,.,{{{{,||{||||{,,{,{{((({,..|}}}}}}))))},.,||||||{.{||,,,...|)}.}}.))),}))}.,)))))))),}..((((((((........))))))))((((((((..(((((.(((((..{(((..((((((.((((({.,(((((({....,(((({(,,,.|||}}}(((..{{{{{{.{|||.|||,,,,..,((({....})))|,,.{{{,,,...((((((...)))))).))))})))}))),)))}}))))))))))))).))))))....,.,{{....))}((((({...}))))).........{{{...}}}...)))}...))))).)))))....)).)))))),,)))))))||}||||}|,|||||||{|{|||,..,})))))}))}||||.{{(((,.....))))},.,,.,|||||{{||||..||||{(((((((,..||}||||,,,{((((((,,..,,,|||}}}|}||||||||||,,}.)))}},}|}}}}}|,||||||}...}||||}||{(((....,.........,.)}}}}},,,))}}|,||,)}{||||||..}))))|||,.,|.,..}}}}|{{{{{.,{((({,,{{|,|,,,,,,,{{{||{....}))}}),||}||||{,,{|}}|||(((({{...,,,})))}),,,.)))))})),})))))}))))})})}}}))})),,)))|||||||..,,,,)))))))))))))}.})))..|||,,,(({{{...,))))),..(((.((((((((((...,..((((.(({......})).))))..,)))))))))).))).....

Transcripts

ID Sequence Length GC content
GAAAUCCGGUUCUAACCGGUCCGGGGCUCCCAGCGCUAUAAAAACUUUA… 1940 nt 0.4407
Summary

The protein encoded by this gene binds nucleosomal DNA and is associated with transcriptionally active chromatin. Along with a similar protein, HMGN1, the encoded protein may help maintain an open chromatin configuration around transcribable genes. The protein has also been found to have antimicrobial activity against bacteria, viruses and fungi. [provided by RefSeq, Oct 2014]

Forensic Context

A study in mice demonstrated that HMGN2 was up-regulated across all seven brain regions examined in ethanol-naïve High Drinking in the Dark (HDID-1) mice compared to control mice, with a fold change range of 1.53–1.83 [Ferguson et al. DOI:10.1007/S12035-018-1252-0]. In human postmortem brain tissue, HMGN2 was identified as a top differentially expressed gene in the dorsolateral prefrontal cortex meta-analysis of individuals with alcohol use disorder [Willis et al. DOI:10.1038/S41380-024-02777-1].