Basic Information

Symbol
HMOX1
RNA class
mRNA
Alias
Heme Oxygenase 1 HO-1 BK286B10 Heme Oxygenase (Decycling) 1 Heat Shock Protein, 32-KD EC 1.14.14.18 EC 1.14.99.3 HMOX1D HSP32 HO1 HO
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_002133.3
Sequence length
1554.0 nt
GC content
0.5766

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-590.30 kcal/mol
Thermodynamic ensemble
Free energy: -616.60 kcal/mol
Frequency: 0.0000
Diversity: 394.25
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((((((.((((((((((.((((.(((((...(((((((.(((((.(((((((...(((((((....((.(((((.((((((.(((..(((((....(((((((....((((.((((((((.(((......(((((.((((.....))))..((((..(((......((..((((((.....)))))).)).....))).))))....((((((((((((....((((..((((((((((.((.........((((((((((.((.((((((((.((.(........).)).)))))))).)).(((.........)))..(((((((..(((((((((((.((((.(.(((...((((((((((.(((((...))).)).))))))))))...))).)...))))....))))).)).))))..)))))))....(((((((((.((((((((....))).)).))))))).))))).((((((.....))))))....(.((((((((((((.(((..................)))))))).))..)))))).(((((((((.(((((.(((((((((((((........(((((.(((.....((((((.(((((......)))...)).))))))....((((....)))).))).)..)))))))))))).)))))..((.......))((((((((.........((((((....))))))))))))))..(((..((.((....)).))..))).((((.....)))).))))).))))))))).((((((((........(((......)))(((..(((......)))..)))((((((..((.((((...((((.(((((....(((........((((......)))))))..))))).))))...))))..)).)))))).(((((.(((....)))))))))))))))))))))))))).......)).))).)).)))))(((((((((((((((((........((((((............((((.(((((....))))).))))))))))...........)))))))))..))))))))((((((.(((...))).))))))...............(((((((..((((...((((...(((((.((((((((..........)))))).)).)))))))))...))..))..)))))))...))))......))).)))))))))...)))))....)))))).(((.((((....))))..)))...((((((.((((.......))))..)))))).........))))))))).....)))))))...)))))....))).))))))..))))).))..))).))))))))))).))....(((((((((....)))))))))(((((((....)))))))))..).))))))).)))))..)))).))))..)))))).)))))))....(((......)))...(((..((.....(((..........))).....))..)))....
Thermodynamic Ensemble Prediction
{((((((.((((((({({.((((.(((((...(((((((,(((((.(((((((...(((((((((({(({.,{(,,((((({,,||,,||{{{..,,(((((((....((((.((((((((.(((,,,...({{{({{(((..{{,{{{{{.{,{|,..,|,.((({.(((((((...((((({.((.(({((((((((.((((.((((.({.(((((....(((((({((((((((..{..(((({....}))))..}.))))).(((..((((((......,(({{.((.{((((((.(((.{{.,{,,...((((((.(((((((..(((((((((((.((((.(.(((...((((((((((.(((((...))).)).))))))))))...))).}...))))....))))).)).))))..)))))))....(((((((((,(,((((((....))).)))})))))).))))).((((({.....}))))).....))))))((((((((.(((.........({{{(({..{,.{(((......))))}))))))))).)))))))),{{{((((((((......,,((({,,{,{,.,,,((((((.(((((......)))...)).))))))...}||,,.,,|||,..}}))),.))}})))))))),))))).))).)))))))}|)))))))))))..))){(((((....))))))||||,,,)}}},,..})}|..})))}.),....)))))..)).)))))))).|||}}|,|||{{{(((,..(({......,||.......}}},|,.{(((.|.,{|||...)))|,|{,.}}}}......}}}))).,,.))),,..)))))..)).)),}))))).))))))).))))))))))(((((((((({(((((...{(((((.(((....))))))))),{(((((...)))))}.,..,{{{{{..((.(((({|(((((((((((((((((((........((((((............((((.(((((....))))).))))))))))........,..)))))))))}})))))))))),,,,.(((...))).)))))))).}}}}}..,,.,.(((((((..((((...((((...(((({.((((((((........,,)))))).)).}))))))))...))..))..))))))).,...))))}...})))))))))).....,))))....}}}})),(((.((((....))))..)))...((((((.((((.......))))..)))))).........|)))))))).....)))))))}..})))).,,,})},}...,..}))))).))..,)).))))))))))).))....{(((((({{....))))))))}(((((((....))))))))},.),))))))).)))))..)))).)))).})))))).))))))}....(((......))).,.(((..((...,{({{..........})},}}..))..)))....

Transcripts

ID Sequence Length GC content
AACGCCUGCCUCCUCUCGAGCGUCCUCAGCGCAGCCGCCGCCCGCGGAG… 1554 nt 0.5766
Summary

Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various non heme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008] CIViC Summary for HMOX1 Gene

Forensic Context

A study in porcine skin demonstrated that bromine vapor exposure significantly increased the HMOX1 transcript at 48 hours post-exposure, with a 5.43-fold increase after 10 minutes and a 4.16-fold increase after 20 minutes [Rogers et al. DOI:10.1002/jbt.20383]. Another investigation in porcine skin found the HMOX1 transcript was upregulated at 7 days after a 45-second exposure and at both 24 hours and 7 days following an 8-minute bromine exposure [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. In a separate investigation using a rat model of obesity-related erectile dysfunction, functional analysis revealed that overexpression of miR-328a in the corpus cavernosum decreased erectile response and concomitantly reduced the expression of the HMOX1 (HMOX1/HO-1) protein and mRNA [Bai et al. DOI:10.1016/j.esxm.2017.06.006].