| ID | Sequence | Length | GC content |
|---|---|---|---|
| AACGCCUGCCUCCUCUCGAGCGUCCUCAGCGCAGCCGCCGCCCGCGGAG… | 1554 nt | 0.5766 |
Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various non heme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008] CIViC Summary for HMOX1 Gene
A study in porcine skin demonstrated that bromine vapor exposure significantly increased the HMOX1 transcript at 48 hours post-exposure, with a 5.43-fold increase after 10 minutes and a 4.16-fold increase after 20 minutes [Rogers et al. DOI:10.1002/jbt.20383]. Another investigation in porcine skin found the HMOX1 transcript was upregulated at 7 days after a 45-second exposure and at both 24 hours and 7 days following an 8-minute bromine exposure [Price et al. DOI:10.1016/j.toxlet.2008.08.007]. In a separate investigation using a rat model of obesity-related erectile dysfunction, functional analysis revealed that overexpression of miR-328a in the corpus cavernosum decreased erectile response and concomitantly reduced the expression of the HMOX1 (HMOX1/HO-1) protein and mRNA [Bai et al. DOI:10.1016/j.esxm.2017.06.006].