Basic Information

Symbol
HNRNPDL
RNA class
mRNA
Alias
Heterogeneous Nuclear Ribonucleoprotein D Like JKTBP LaAUF1 HNRPDL Limb Girdle Muscular Dystrophy 1G (Autosomal Dominant) Heterogeneous Nuclear Ribonucleoprotein D-Like AU-Rich Element RNA-Binding Factor JKT41-Binding Protein Protein LaAUF1 HnRNP D-Like HnRNP DL LGMD1G A+U-Rich Element RNA Binding Factor JKTBP2 LGMDD3 HNRNP
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Time since deposition estimation

MANE select

Transcript ID
NM_031372.4
Sequence length
4372.0 nt
GC content
0.4597

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1403.00 kcal/mol
Thermodynamic ensemble
Free energy: -1485.10 kcal/mol
Frequency: 0.0000
Diversity: 1312.71
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
........((((.(((((((((((((((((((....)))))))))..)).....(((((((((((((((((.(((..(((((((.((((....((.(((((....).)).)).)).....)))).)))))))..))))))).(((....))).((((((((((.........(((((((((...........(((.((((((...((((.(((((((((.(((.((((((((((((((.(((((.((((((((((((((((....))..))))))...)))))))))).)))...)))))(((((....))))).......(((....((((((((((((.((.((...((((...((((((((((.(((....((((((((((((....)))))))...)))))......))).))))))))))((((((....)))))).)))).)).))))))).)))))))..)))(((((((((..........((.((.(((((((((((((.(((.((.((....)).)).)))))).))))))..)))).)).))))))))))).))))))))).).....)).))))).)))).))...))..))))))))))))))).(((...((((((((((((.....((((.(((((((((.....)))..))))))..))))...((((.((((((((.((((.((((((((((((((((.......(((((.(((...((((.(((((((((.(((((......)))))))))))).))))))...)))...)))))(((..((((..((.(...((((((.(((((((....((((...)))).....)).(((.........)))(((((((((((.(((((((((.(((..(((.((((((((.((.(((.(((.((.((((((((..((((((..((.((((...(((...)))....)))).)).)))))))))...)))))))))))))))....)))))))))))..(((((((..((((.....))))................(((..........))).)))))))))))))))))))...))).))))).))).(((......))).(((......))).....)))))....))))))...).))..))))..)))....((.....((((...))))...))))).))))))))).))))....((.....((((((..((((((((..(((........)))......((((.(((((.....)))))..))))((((((((((((((...((((((((((((.(((..(((.((((((.((((((((((.((........)).)))))....))).)).))))))))).(((((((((((..((...............((((.............))))....))..)))))))))))(((((((((((((((.......))))))))..((((....(((((..(((.(((((((((((..................(((((((((..(((((..(((((.......((((((((((((((...(((((((..............))))))))))).)))..........(((((((((.......(((((....)))))..........))))))))))))))))...........(((((...(((......)))......)))))....(((.(.(((((..((.(((((((((((((..((((((((((((((((((.(.((.((((.((((....)))).))))....)).).)))...((((((((....)))).))))...(((((((((..(((((......(((((((..........)))))))(((((((.(.((...((..(((.(((..((((.((((((...)))))).))))..)))..)))..))..)).).))))))).((.(((((..(((((((((.....(((((((.(((.(((..........))).))).))......((((((((((((((((.....((((((......((((((((..((((((...((((((((..(((((....)))))))))).))))))))).)))))))).......)))))).(((((((.(((((....)))))....)))))))..)).)))))..))))))))).......)))))..)))))))))..))))).))....((((((............))))))....)))))...)))))))))..)))))............(((((....(((((((...((((((((((........)).)))......))))).........)))))))...)))))(((((((..(((((((..(.......)..))))))).)))))))))))..........)))))))))))....))))))))))..))))).).))).)))))..)))))))))))))))))))(((((((...(((((((.((((....(((.(((((((((((.....((((.((..((((((((...((((....(((((..((.((.((((((((((((...((((((((((((..((((((.........(((((((((((....))))).))).)))...........(((.......)))((((((.....................))))))......))))))..)))))..))))))).))))))))))))..)).))..)))))))))....)))))))))).)))).(((((((((((((((.....(((((.(....((((((((((.(((...(((((((..(((((.((.((((((((......((((((((..............(((((.............(((.((......)).))).)))))..))))))))......)))))))..).)).))))).....)))))))...))).))))))))))..((.(((....))).)).).)))))....))))))))....)))))))...(((((((((.((.....(((((.(((((......))))))))))..)).)).)))))))(((((...))))).......((((((.((((((.......)))))).))))))..(((.((.((((((((.(((((((((.((((((((((((((.(((((((((....)))))))))...)))))).....))))))))...))))))))).)))))....))).)))))..(((((((.....)))))))...)))))...)))))).)))....))))..)))))))....))))).))............)).)))).)))...)))))...)))))))))))))).))))))))..))))))))))))))))))(((..(((((.(((((((((((.(((.((((....((((((((((((.(((......((......)).......)))...)))))))).....(((((((.((.(((((....)))))..)).)))))))(((((((..(((((((((......))))))))))))))))......)))))))).))))))))))).)))))))).)))..(((((..(((.((((((((.((.(((..((((.......))))))).)))))))))).))).))))).)))))))).))))))....))(((((((((((((..(((.(((.(((((............)))))....))).)))..))))))))).)))).....)))).))))))))..)))).....)))))))))))).)))((((((...(((((((((((((((((((.(((.((......))))).)))))))))))((((((((((((((................((((((.........))))))...)))))).))))))))............((((.(........))))))))))))).))))))....))).........)))))))))).(((((.....)))))..((((......(((((((...(((((.......))))).)))))))......(((((...((((......))))...)))))(((((((.....)))))))...............))))......(((((((......((((((......))))))..))))))).....))).))))))).)))...))))))))..)))).((((((((....(((..((......))..)))..((((.(((....(((.((((((((....))).)))))..))).....))).)))).))))))))
Thermodynamic Ensemble Prediction
........{(({.({((((({({(((((((((....))))))))),,}}.....(((((((((((((((((.(((..(((((((.((((....{{.{({(({,,.,.}}.}),)},,,,.)))).)))))))..))).{{{{((({{{{{,,.((((((((,((.((..((((((((((({(...,,.....(((.((((((..,(({(,(((((((((.({({((((((((((((,,.(({(({((((((((((((((((....))..))))))}..,)))))))})})))|{{||||}{((((,({{|||||{{...,{{{{.,,.((((((((((((,((,((...((((..,((((((((((.(((.,..({((((((((((....)))))),}}})))}}......))).))))))))))|(((((....)))))).)))).)}.)))))))},))))))..}}|||{{{{{{|,|,.,..,.}||}||,||||||{{(((((,,((.(,{(({{{.,,.))})))))),))))))}.,)))})))}.,,,,,,))))))))))))).).....)).))))).)))).))...))..))))))))).,,}})},|,,}}||,,{{(((,{{{{{{.((((.(((((((((.....)))..))))))..))))...||||}||||||(({{,{({({{,((((((((({,,.......,{(((,(((,..((((.,{(({{{((,(({{{.,,,,.}||||||}}|||,|||}||,..}||...||}},,{|,.{|{|,.||},}}}||||,,,|||||({....((({...}))).....}}.(((.........)))(((((((((((.(((((((((.(((..(((.((((((((.((.(((,(({.((.((((((({..((((((..((.((((...(((...)))....)))).)).)))))))))...)))))))))))))))....)))))))))))..(((((((..((((.....))))..}}............(((..........))).}))))))))))))))))))...))).))))).))).(({......))).{{{...,,,}|}....,)))))....}}}}))},.}.)),,,,,)},)),...|||.},}}|(((...)))}..,})))),))))))))).)))).})}|{,,...,|||||..||||||,|}.||,}}}}.....,,.....{((((.(((((.....)))))..))))}||||,((((((((,{{((,({{{,,,.((((((((((((.((,{....,}.,}.,))}}}))))))))(((({{((,((,{{((((((((.{{,.{{((((({{((..((...,.,.|,,..,,|({{{,,||..,,,.....,||{...,)}}||||||||||}.{(((((((((((.......((((({...,(((((((((..,,.(.(((.(((....(((((..................(((((((((..(((((..(((((...,,..((((((({{(,,,,,.,(((((((..............)))))))||||,,,,...,||,},.{(((((({|.......,((((....})))|,.,..,....}})))))))))))))).......,...(((((...(((......)))......)))))....{({.{.(((((..((.((((((((((,(({.(((((((((((((((((((((({((((((((((,.,{{{,{{||}|{,,..|{{,{|,,{{{{.,,,,,.,,,{,,.((((((....(((((..({({...})))..)))))....)))))}...{{{|{{(.,(((({(.,,.,.{,.,{{{,{||.,||||.||||||..})))))).,,||{.((|..(((,((((,,.,{{{|||||{.,{{,{{{||.{{(((,.{{,.{{{{...{{{(((({...,,,,..........,,.))))}.}}...,}|||(((((((((,.,{{({,{{{...},,{(((((((..((((((...(({(((((..(((((....)))))))))).))))))))).)))))))}.......})))))}||||,{,.(((((....)))))...,)))))))..)))))),,,})),}))))))))}),.,)))),})))}))})))},,))))))))))((((((..{......}..))))))...}))))))))))))........{{{..,.,...{{{{{.,{({,.,(((((({{,,.{{||,||{||,.,,,,..,,,.)))}..,,},))},,,......))))),}..,},)))(((((((..(((((((,.{.......)..))))))).)))))))))))..........)))))),,))).}},))))))))))..))))).}.))).)))))..))))))))))))))))))).....))).))).).,,)))))))))))))).......)))))))))))|{{...((((((((.,,((((....{((((..{(.{,.((((((((((((...((((((((((((..((((({....,..,.{{{{,{{{{((,...,}}}|{{{{.|||..,|}|,.,,|{((.,,.,..))||{{{{(.....{{,{,,,,||||,...))}}}}}..,,,))))))..))))),.})))))).))))))))))))..}}.))..)))))))},....)))))))),...}}},|||{{||||||||||,}}.}|||{|},...,|||||||||,.,||}}}|||||||...}}||}||}}}}}}.(({(({{{((((((((....,,,,,,,,..,,((({{{,{,.,{,.,.{||,|,,{(((((((.{,.{{{,({((,..(((({...})))),,,,)}}})))..}))))))))},,|||{|{|}}.}))))))|||{.,,.,,|}}}.....||{{{|||||{...,}}||}},{{,{}}}}|}||,,{{((((({{.,,.....(((((.(((((......))))))))))..,|.,,.)))}}}}|((((...))))|.,,....((((((.((((((.......)))))).))))))..(((((.((((...)))).)))))...{(((((((((((((.(((((((({....})))))))).,.}))})),,,..)))))))){|.||||||...{{{.{{||||||{{||{{|{{((.(((({,...},,|(((((((((.(((.((({....})))..))))))))))))},.....,{|||..,,},}.{,|||,,,.})),}}},.,|.{{,.||||{|{|||{,,....,|||||||,.|||||||||||,,,||||({(..(((((.(((((((((((.(((.({{{....,||,((((((((.,{{,..,..((......)).......))}...))))))))..,,.({(((({.((.(((((....)))))..)).))))))}(((((({..{((((((({......)))))))))))))))),,,,...,}})))).))))))))))}.})}))))).}}}..(((((..(((.((((((((.((.(((..((((.......))))))).)))))))))).)),.))))).,,,|||||,||,,,,....,,(((((((((((((..(((.(((.(((((............))))).,,.))).)))..))))))))).)))).,,,.,}}},}))))))),.|||{{{{..,,.,,))))))),)))}}}|||,.,||||{{{,{((((((((((.(((.((......))))).)))))))))||((((((....})))))}}}}}}||||...,|}}}}}...}}}})))),)))}}})))),)}),,)))))}}}}}}}})))))||(((.{((({{{,||,.{||||,|..{{{,,,..}))..}}))))..})))))),))),(((((.....)))))..,,......,,(({((((...((({{.......))))).))))))),,.,,,,,|||,}}},))})}}}))),,..{||{.{(((((((.....)))))))}..,}},...,....})))}}....(((((((..{{..((((((......))))))}}))))))).))))))).))))))}}}))...})))))))..}))}.{(((((((....(((..((......))..)))..{(({.{{{.,..{{,.((((((((....))).))))},,}}},,,..))),)))}.))))))))

Transcripts

ID Sequence Length GC content
GAGGCCGCGCGGGGCCCGGGCUUCGGCCGAUCAGCCCGGGAGGCCCCGC… 3986 nt 0.4463
AACAAAGAAGCGAACGCGGGAGCAGGGUGCGCGAGAGCGCGCCCUCCGC… 4372 nt 0.4597
Summary

This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two RRM domains that bind to RNAs. Three alternatively spliced transcript variants have been described for this gene. One of the variants is probably not translated because the transcript is a candidate for nonsense-mediated mRNA decay. The protein isoforms encoded by this gene are similar to its family member HNRPD. [provided by RefSeq, May 2011]

Forensic Context

A study in humans developed a targeted RNA sequencing protocol to predict the time-of-day of bloodstain deposition using 69 candidate mRNA markers, including the HNRNPDL which was included as a candidate from previous publications [Gosch et al. DOI:10.1016/J.Fsigen.2025.103287]. A study in humans demonstrated that the HNRNPDL exhibited a Gini impurity score of 0, being present in all pure vaginal fluid samples but absent in mixtures containing vaginal fluid and in mixtures without vaginal fluid, identifying it as a discriminatory protein for body fluid classification [Shehata et al. DOI:10.1016/j.fsigen.2025.103343].