| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUCGAAUGCAGCGUCUACGCCUGGUGAAUGGACGCACUCUUACCAAUUC… | 2416 nt | 0.4611 | |
| CAUUUCGUCUUAGCCACGCAGAAGUCGCGUGUCUAGUUUGUUUCGACGC… | 2199 nt | 0.4266 |
This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012] CIViC Summary for HNRNPH1 Gene
A study in humans demonstrated that the HNRNPH1 was identified as a housekeeping gene in the immune and related functions class and was differentially expressed between a specific male monozygotic twin pair, belonging to the least variable category of gene expression variation [Sharma et al. DOI:10.1152/physiolgenomics.00228.2003].