Basic Information

Symbol
HOXA10
RNA class
mRNA
Alias
Homeobox A10 HOX1H Homeobox Protein Hox-A10 Homeobox Protein Hox-1.8 Homeobox Protein Hox-1H Homeo Box A10 HOX1 PL Homeobox Protein HOXA10 Homeobox Protein 1H HOX1.8
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification

MANE select

Transcript ID
NM_018951.4
Sequence length
2541.0 nt
GC content
0.5431

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-966.50 kcal/mol
Thermodynamic ensemble
Free energy: -1011.01 kcal/mol
Frequency: 0.0000
Diversity: 678.56
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((((((........((((((((((..((((.....))))..........................((((.(((((....((((((((((...(((.((((((.((((...(((....))))))).)))))).)))....))))))).)))(.((((((((((((((((((((((((((((.(((.((((...)))).)))..))).)))).)))))))))(((((((((..(((((((.(.(..((((((.(..((((..(((.((((((..((((......)).)))))))).))).((((.(((((((((((.((((((((..(((((((((..(((((((((...((.......)))))))))))....)))))))))......(((......))))))...))))).))))))))))))).)).((.(((((((((.(((((((..(((.(((.((..(.((((.(((((.....((((((....(((((............((((.((.......)))))).....(((((((......(((..........))).....)))))))...((((((........)))))).((((.....)))))))))...)))))).....((((((((((((...))))).)).)))))........))))).)))).).))...)))...)))..))))))).))))))).)).)).....))))..)))))))..).)..)))))))..)))))).)))........))).))))))))).)(((((((..(((...(((.((((((((((.(((((((((((..((((.(((((...(((...)))...))))).)))))))))))))))(((((((((.(........).))))))))).(((((.((((.....)))).)))))))))))).).)).)))..)))..)))))))(((((..(((.((((...(((...(((..(((((((((((...(((((((((((((....((((((((.((((.(.((((...((((.(((.((((...)))).)))((.((((((((....((.((...)).))...))))....(((((............)))))...((((.......)))).............((((((((((...((...)).)))))))..))).........((((((((((..(((.((((.((((((................))).)))..))))..).))..)))))))))).))))))((((.((((................)))))))).((((((((....((...((((..((((........))))....))))...))....)))))))).........))))..)))).))))).))))))))...(((((((....((((((.(((((.((((((.(((.((........)).))).))))))))))).))..)))).....)))))))((((((......)))))).(((((.....)))))...))))))))...((((((..............)))))).(.((((((((...((((((...(((((......))))).....))))))..)))))))).).((((((((((.((.((((.....)))).)))))))))))).....)))))(((.(((((((....))))))).).)))).))))))))).)))...))).....))))..)))..)))))...(((((((((..........))....)))))))(((.((..((((....))))..)).)))...))))).)))))))))))))).....(((.((((((..((.(......).))..)))))))))....)))))))).((((((((((..............((((.....((((((((....)))))))).....))))((.((((........)))).)).....((((((.((((((((............((((((((((((((((((((.........)))))))))......((((((.((((.....((((((((......(((((((...))))))).))))))))....)))))))))).......((((((....(((((............(((((((((((....)))))))))))............))))))))))).)))).)))))))..)))))))).))))))..((((((((.(.(((((((((((.(((((((........).)))))).((((((((..(((......)))(((((((((((.........................))))))).......(((.((.(((((((((.((.....(((((...)))))..))))))).)))).)).)))((((((((((.((..((((((((..........))))).))).))))))))))))......)))))))))))).....))))))))))).).))))).)))....))))))).))).....
Thermodynamic Ensemble Prediction
((((((((...,....((((((((((..((((.....||{||,|,{{{{,.......,,,,......{{{{.(((({..||{(((((((((...(((.((((((.((((...(((....))))))).)))))).)))....))))))).})}{{({(({{{{{|(({(((((((((((((((.((,.((((...)))).|))..))),))))}}}))))))}{{{{(((({..(((((((.{.{..{{{(((|{..((((,.(((,((((({.,(({{.....,||,|||}})}},||}.((((,(((((((((((.((((({(({.(((((((((..(((((((((...{,.......),)))))))))....)))))))))....|}|{{.,,,..))))),,.,,}))),))))))))))))).)).((.(((((((((.(((((((..(((.(((.((..(.((((.(((((...,.((((,,....||||||.........,.((((.((.......)))))).....{{(((((......(((....,,,.,,|||.....}}))))),,,((({((,.....,.))))}}.(({(,,...}))),)}}}.,{}|||||,,,..{{||||||||||.,.}}))).,,.})))),.......))))).)))).).))...)))...)))..))))))).))))))).)).)).....||||,,|||}}}}....,,,))))))),.)|||||.||}........)))})))))))),})),|((((((((((((.{{{{{,(((((((.(((((((((((..((((.(((((...(({...}))...))))).)))))))))))))))(((((((((.(........).))))))))).(((((.((((,...,)))).)))))))))))),{{{(((((((,((,.(((,{...(((((((((((((....,}},.,}|,|,...{{,((((....)))}.,|{(((((({{.{(((((((.((((.(.((((,{.((({.(((.((((...)))).))|{({((((({{,....,,.,.....,.,)}}},))).,,.(((((............)))))...((((.......))))......|||....{{{(({{{{{.,.||.,,||.}|}}}}}|,,|,....{,,..((((((((((..{((.((((.((((((..,,........},..))).)))..)))).,).}}..)))))))))).,))),,((({.{{((....,...,,,.,.,,)))))))).((((((((....((...((((..((((........)}}}....))))...))....)))))))).......,,}))).})))).))))).))))))))}}}}}}}|||||||{{{,((.(((((.((((({.{((.((........)),))).})))))))))).)).,},...,}}})))))..((((((......)))))).})))))..,},))).)),))))))))}},((((((..............)))))).)}}.)))))))))))))||,.}|||||,,,.,,)))}}.{{{{.(((,,..))),.)))|,,((({((((((.((.((((.....)))).))))))))))))...,})}})}(({{((,,((({{{{{||||||{{{|{,..,,.,.......{((((((.......))))))},...,,..,,,{{{{,,,{(,,,.......}}..}}))))))}))}}.)))))}.,))))))).})},)))...})))),),,})))))))))).....,{|.((({({|,{{.,......}.}}..})))))})).,},)))))))).((((((((((..............((((.....((((((((....)))))))).....))))({.((((........)))}.}}.....((((((.((((((((............((((((((((((({{((((({{{......,)))))))).,....((((((.((((.....((((((((......(((((((...))))))),))))))))....)))))))))).....,,,{(((({...,,,,,...|||..||..,((((((((((....))))))))))}.....},.....}}},)))))))})))).)))))))..)))))))).))))))..{{{{((((.{.(((((((((((...(((((....,,.,|{|,}},},||(((((...(((......)))....}}|||,...................{((({....)))))..,,,..{{,.,,.((((((((,{((.....((((,...})))).,))))))).)))).,,.||}{(((((((((.{{..((((((((..........))))).))).}}))))))))))}}}..{|,,,.}}))},))))}.))))))))))).}.))))}.)))....))))))).))).....

Transcripts

ID Sequence Length GC content
GUUUUGCACAAGAAAUGUCAGCCAGAAAGGGCUAUCUGCUCCCUUCGCC… 2541 nt 0.5431
Summary

In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor that may regulate gene expression, morphogenesis, and differentiation. More specifically, it may function in fertility, embryo viability, and regulation of hematopoietic lineage commitment. Alternatively spliced transcript variants have been described. Read-through transcription also exists between this gene and the downstream homeobox A9 (HOXA9) gene. [provided by RefSeq, Mar 2011]

Forensic Context

A study in humans demonstrated that the mRNA marker HOXA10 is expressed in venous blood, menstrual blood, and semen, as assessed by TaqMan probe qPCR [Liang et al. DOI:Not mentioned].