Basic Information

Symbol
HOXB13
RNA class
mRNA
Alias
Homeobox B13 Homeobox Protein Hox-B13 Homeo Box B13 HPC9 PSGD
Location (GRCh38)
Forensic tag(s)
Tissue/body fluid identification Mixture deconvolution

MANE select

Transcript ID
NM_006361.6
Sequence length
3039.0 nt
GC content
0.5772

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-1219.60 kcal/mol
Thermodynamic ensemble
Free energy: -1270.58 kcal/mol
Frequency: 0.0000
Diversity: 868.02
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
.(((((...)))))....(((.((.(((...((((((...)))))).))).)).))).........((((((((((..((((((((((((((((((((.(((.((((((...((.(((((((..((((((...((.((((((((((...)))))).))))(..((((((((....(((.((((((......))))))........)))))))))))..)))...))))))))))))))).)))))))))..))))..))..)))))))).(((((((..((((.((.((((((....((.(((((((((((.((((((......))))))(((.((((((....((((..((((..(((((((((((...))).)).))))))....)))).....))))..)))))).)))(((.((.((((.....))))))))).(((((.((((....((((....)))))))).....(((((((((((((((((((...)))..((((.((((.......)))).)))).(((.((((((((((((((((...(((((.(((((((((...(((.....)))...))).))))))((((((.(((((.....(((((((....))))))).))))))))))).((((((((((.((((...(((((((((((...........)))))))))))..)))).))).........)))))))...............)))))...)))))))))((....)).)))).))).)))((((....(((((.((.((((.((((.(...((((..((.......))...))))...).)))).)))).)))))))))))..))))).)))))))))))...)))))....))))))......)).)))))....)))))).)).)))).....)).)))))((((....))))((((....)))))))))).....(((((.....)))))((...((((((((((((.(.....(((((((.......((((((((((((((..((((....(((((((((....((((((...((((((((((...(((((.(.((((((...((((....(((((.(((.....(((........)))((((((((....(((.((((........)))).)))))))))))......((((((((((((.(......)))).)))((((((((((((((((.((((((.....)))))).(((((((((((((..((((((.(((.(((((........(((((...((((....)))).....)))))...........((((((...((.((((....)))).)).))))))))))).))).))..))))...)))))).........(((((((..(((((....))))).))))))).......((((((........((((((..((((.......))))..))..)))).)))))).(((((((.....(((....))).....)))))))(((((..........)))))..))))))).)))))).....)).).)))))))(((((((((.(((((((((.((((...((((((..(((.......)))..)))))).......(((((((((....)).)))))))........((((....))))(((((((((((((((((..(((....))).))).)))).(((.((((...(((........)))...)))).)))...((.(((((.((.(((((((((((....((((((.(.((((((((......)))).((((..((.((.((((.((....))))))..((((.((((((..((.((.(((.((((..((((((((((...((((((.((((((......)))).)).))))))..((((....((((.............)))).....)))).....((((((((...((((((....))))))(((((((.((((((((((((.((((....)))).))))))).))))).)).)))))....((((((.....))))))(((((((((...((((((((((...........(((((((.((((((((...((((.((((((......)))))).))))...))))))))....((((.((((.((.((....))))..)))))))).)))))))....(((..(((...)))..)))(.(((((((..((.(((((((...(((.(((.((((((((((((.(...).)))))....((..((((.......))))..)).)))))))))))))...))))))).)).)))))))).((((........)))).)))))))))))))).)))))...))))))))...))))))))))..)))).))).)).))....)))))).))))...)).))..))))...)))).))))))).)))))))..)))))).))))).))..........))))))))))...))))....))))))))))))))))))...((.((((((...........)))))).)).....(((.((.((.......)).)).)))..))))))))).))))).(((((......))))).......))))((((...)))).))))))).))))).............)))))))))).)))))))))))))))..))))...))))))......))))))))....((((((((((.(((.(((.(((((((......)))))..)).)).).)))....))))))))))...(((((..(((((((((.(((((((...((((...))))..(((((((((....(((((...(((((..((((((..((((((.....)).))))..))))))...)))))...)))))....)))))...)))))))))))....))))).).)))..)))))...........))))))).....).)))))))))))).))....))))))))))........
Thermodynamic Ensemble Prediction
.,,(((({.,..,.((((.((.(((((,....({(((,..}}}|}((((((((.(((.........|||||((,|{,|||||||((((((((((((((.(((.((((((.,.,{.(((((((((.(((((((.(({({((((((({.{{{,||||{{||.{{{,,,((((....}}}}.,|||,|,}}}}})),)))........)))))),}))).))))).))}})).))))))))).)))))))))..))))..}}..)))))))){((((.{,.((((((.((((({.{{{..,,,........}})....)}))))))))))).}).)))),,,|}...|,..,,|.,.(((((((....))))))),},)},)))))))){{{{({{,,,,}},..(((((((((((((.,,.,,,|||||||||}|||||({.(((,((((,...(,(({{{{||||,,,,...},||(((((((((((((({{{,.,||||.((((.((((.......)))).)))).(((.((((((((((((((((...(((({.(((((((((...(((.....)))...))).))))))((((((.(((((.....(((((((....))))))).))))))))))).((((((({,((((,(((.(.(((.((((({.,.({{....))),),)))))}})),)))).}.}.},.,.)))))))........,.....,)))))...)))))))))((....)).))))}})).))){{({.,{{({(((.((.((((.((((.(,,.((((..((.......))...)))).}.).}))).)))).))))))))))}..))))).)))))))))}}....((((........))))..,.)))))}.},,,)))))))}.,)}.))))).})))).(((((((....))))))),)))).}}.)))){{{....(((((.....)))))||}..((((((((((((.(.....(((((((.....,.((((((((((((((..((((....{((((((({..,.((((((...{(((((((((..(((,,,.}}|((((((.....(((....})).)))))).,,.,...,{,{{{{.((((((((.,,.{((,{{((.....,,,,))).))))))))))),{(((,((.{{{|{,|||{{{,((({{{,..,(({{{(({{{{{..,,|{,||||||,....|||||}}}{{{,{(({{{((.,{((({,.(((.,(((({.......(((((...((({....})))...,.})))}..,,,......{(({{{,,,((,((((....)))).}),)))),,,||||,||}.||{{|}},...,}}}}),...,,}}}{||||||,.(((((....))))).}||||||{,{{{.,(({{(({,....,.({((((.,((((.,...,.}}||,{||,{}|||{|,||||((((({{{...,,|||}},.)))})}.})))))))}..{{,,,,,||||,||||||||}}||||}(((((((({.....((((..{...|..))}}..,,.})))))))).....((((((..(({.......)))..)))))).,..,,.(((((((((....)).)))))))........((((....))))||||||,|||}||{{{{,,{{{..,.)},.,,).}},,}|||}||||}}.(((........))}...,,,..,,,,}}|..,|||,,||}|||||||{|{....,{{(({(.({((((((((......))))|{{,({....}}.}}},,||},}})))},},,{({{.{((((({.{{.{{.({,.((((..((((((((((...{(((((.((((((......))))},).)))))}..((((,,,.((({.......,,....))}),,...)))).,,..((((((((...((((((....))))))(((((((.((((((((((((,((((....)))),,)))))).))))).)).)))))....({((((.....))))))(((((((((,,.(((((((((({,{....||{,((({{{{.{{||||({..,{(((,({((({....,,)))))),))}}.,,}))))}}}....{(((.{{({.{{,{{....))))..}})))))).})))))).,..(((..(({...)))..)))|,(((((((..((.(((((((...(((.(((,{({(((((((((.(...,,))))))}},{(,,((((,......))))..}),}}}}))))}))}}...))))))).)).))))))),.((((........)))).}))))))))))))).))))}.,,)))))))).,,))))))))))..)))),))),)).))|...|||}}}.)))}...}},,.,,,},,.,,,))))}}}))),}))))))),.,)))}}.}))))}))}).},,,,.,))))))))))}}.)))({,(((((((.((((({(((((.{{,((.((((((..,........)))))).)).....(((.((.((.......)).)).)))......,.|{{{{{...})),})))})))))).))}})}.))))))}|}}}..{|{{{||||...,))),.))))))....,,)))))))))).)))))))))))))))..))))...))))))......))))))))....(((((((((({(((.{{{.{{{{{((......}))))..}},}}.}.)))..}.))))))))))...(((((..(((((((((.(((((((...((((...))))..(((((((((....(((((.{.{((((,.((((((..((((((.....)).))))..))))))...)))))..,)))))....)))))...))))))))))},...))))).).)))..)))))...........)))))))..,..).)))))))))))),))}........,}}),,.......

Transcripts

ID Sequence Length GC content
CUCUUGCGUCAAGACGGCCGUGCUGAGCGAAUGCAGGCGACUUGCGAGC… 3039 nt 0.5772
Summary

This gene encodes a transcription factor that belongs to the homeobox gene family. Genes of this family are highly conserved among vertebrates and essential for vertebrate embryonic development. This gene has been implicated to play a role in fetal skin development and cutaneous regeneration. In mice, a similar gene was shown to exhibit temporal and spatial colinearity in the main body axis of the embryo, but was not expressed in the secondary axes, which suggests functions in body patterning along the axis. This gene and other HOXB genes form a gene cluster at chromosome the 17q21-22 region. [provided by RefSeq, Jul 2008] CIViC Summary for HOXB13 Gene

Forensic Context

A study in humans demonstrated that the mRNA biomarker HOXB13 exhibited high specificity for semen identification but showed cross-reactions with some saliva samples [Yu et al. DOI:10.1016/j.fsigen.2025.103416]. This marker was included in a target RNA sequencing panel of 135 RNA-SNPs, which successfully identified body fluid contributors in artificial mixtures and achieved a high cumulative discriminatory power.