| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUUUUGGUGUAAAUCUGGACUCUAAUUCUGUAAUAUAUCAAGGAAUCU… | 1363 nt | 0.5077 |
This gene is a member of the Antp homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of melanoma and ovarian carcinoma. [provided by RefSeq, Jul 2008]
A study in rats demonstrated that the HOXB7 gene, a homeobox protein, was significantly upregulated in fetal cardiac fibroblasts compared to neonatal cells and was core-enriched in developmental gene sets, indicating its role in age-dependent transcriptional programming during cardiac development [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].