Basic Information

Symbol
HOXB8
RNA class
mRNA
Alias
Homeobox B8 HOX2D Homeobox Protein Hox-2.4 Homeobox Protein Hox-B8 Homeobox Protein Hox-2D Homeo Box B8 HOX2 Homeo Box 2D Hox-2.4
Location (GRCh38)
Forensic tag(s)
Other applications

MANE select

Transcript ID
NM_024016.4
Sequence length
2176.0 nt
GC content
0.5703

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-791.30 kcal/mol
Thermodynamic ensemble
Free energy: -828.18 kcal/mol
Frequency: 0.0000
Diversity: 628.30
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
((((...............))))...(((((((.((((((((((((((.(..((..((((((((......(((..((((..(((..((((.((.((.((.((((((((......((((((.((.((...(((((.((((((((((((((....(......)....)))))......)))))))))((((......)).)).....)))))...)).)).)))))))))))))).........((((..(((((.....(((((((..(((..(((...(((((((((((((.((((((((((.(((.(((.(((((..(((.(.((((........)))).))))...........((((((....)))))).(((.....)))((((((((((.((.((.((((((((................................................)))))))).)))).))))))))))...))))).......))).))).)))))))...))).))))))))))))).............)))..)))....)))))))((((((((..(((..........(((((((((((..................(((((((...........((((.((....)).))))...........(((((((((((((..(((((((((((((((((...((((((((...(.(((.....(((((((..(((...)))..))))))).......))).)..))))))))...))))..)))))))).)).)))..(((((..((.((.((((((((((((((((..((((....(((..........)))......))))..)).)))))).........)))))))).)).)).....)))))(((((......)))))..(((((((((..((((.((...((((..(..(((.((((((((......)))))).)))))..)...))))...))))))..)))...)))))).((........)).)))))))))).)))..........(((.((((...)))))))))))))))))))))..))))..........)))..))...))))))....))))).)))))).)))).)))).)))..))))..)))(((...(((((((....)))))))...)))((((((.....(((((((.....(((((...(((((((.((..((((.(((.(((((((..(((((...(((((((((((.(((...((((((.((.((((((((((((((.(((((((((.((((((((...(((...(((.(((((((...((((((((((.((((((......))))))..((((...))))..)))))).))))..(((((.....((((((((((((....)))))))).))))))))).......(((.(((.....))).))).))))))).)))...((((((.((..((..((((((........))))))((.(((.(((((............)))))))).))((((((((((((......(((((((((....(((...(.(((((.(((.((((..((...(((...))).))..)))).)))))))).).))).....)))))..)))).......))))))))))))...((((..((..(((((.......)))))...........))...))))........))..)).)))))).......)))....))))...)))).))))))).............)).)).)))))))))....(((...........)))........................)))))))))))...))).((((....))))......))))))))))).)))))..)))))))....(((......)))..((((....))))..(((((..((((....)))).)))))..))).))))..)))))).)))...))))).....)))))))...))))))))).)))))..)).........(((((((....)))))))).)))))))))))))).......((((((((((..((((................(((((.(((....))))))))))))..)))))))))).....)))))))......
Thermodynamic Ensemble Prediction
,{{................||}|...(((((((.((((((((((((((.(({(({{((({((({...,..((((((.{((((({{.{{,|{{{{|||{{.((((((((......((((((.(({({...,,,(({(((,,,,{,(((((....{{{{{{{{{{...||||......)))))))),((({......)).))....,)))))}}})).)}.))))))))))))))....,{{,{{{({{{,,|,||,,.,((((.(((......,(({{.(((((((((((((.((((((((((.(((.(((.(((((.((((..,,{{{,.,,,{,.,,,{{{({{..,,..},},.{{(({{....}))))}.{{{....,})}}|,.(((||,{(({...}}||,|||.......................{{(({......(((((.((......)).))))).))..))))),.))))...))))).......))).))).)))))))...)))}))))))))))))}...,))}))}).)),,}}...(((({{||{{{{{{{(({({,({{.............}}}}....{{{{{.{..(((.....))}..}.}}}}}....,{{((({.({.{{{||{||||.........{{(.({(((.{(((((((,.,|||||||{{{(((...((((((((...,.(((.....(((((((..(((...)))..))))))).......))).}..))))))))...)))),}))})))},.(((((.......((((....((((.(((((((..((({.,(((...)))))))....))))))))))).....)))).......)))))....,)),))))})).,}....}))))|(((((......))))),.{{{{{{{|{.,|,{|,||}..||||}.|},|||{((((((((......)))))).)))}}..,...))))}}}))}}|}.|||}...}}},)),}},)}.))})))}))))))),.|{{{{.(((((((((((..,{{({,..{((((..(((((((((({{,..............,.,|},||,..,{,{|||,..|||,,,.}))..}})},}|}}}.,},((((((((.((((((...,((((((.((((...(((((((|.{(.(((((...(((,((........,.((((((((.((.((....))..)).)).)))))}|((((...(({{((.((((((((.....,,((((((((.((((((.((.{.{.(((((((.(((((((({{{(((,,,({({(((({{{,|,|((((((((({((((((......)))))}..|))))}})}}}},,||}||.||||,.{((((,{{{,((((((((((((....)))))))))}}))}|||,.......(((.(((.....))).))).,))}))).)))...((((((.{(,((..{(((...}})).,}.))))))))|,(((.,,,,.}|||,}}}}}})))))},)}))((((((((((((,.....(((((((((....(((...(.(((((.(((.((((..((...(((...))).))..)))).)))))))).,.))).....)))))..)))).......))))))))))))...{,,|{{((,,,,,.|,...,,.,,}||||,.,...,|,},...|||,....,......,))}}},))),,},...}}}....,})),,.)))).))))))).....}).)))))),}))),)))))))))))).))))).)))}.,,..}}.))).))))).}}....})))))}......)))).}}}}..||||....,)))))})))))))).,.,))}.)))))))..))))}...{,,......))}..((((....))))..(((((..((((....)))).))))).,),,.,...))).))))))))...)))))...||{|,}|,,.,,,,)))}})))})))}..},,|}}},,.,||{{|||..,,}))}}))).))))))))))))))....,,.((((((((((..((((..,,........,...(((((.(((....))))))))))))..)))))))))).,,..)))))))...,..

Transcripts

ID Sequence Length GC content
CGCUCUCUCCUCACUCCCUGGCGCUCUCUCGCUCUAGCUCUCUCUCUCG… 2176 nt 0.5703
Summary

This gene is a member of the Antp homeobox family and encodes a nuclear protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded protein functions as a sequence-specific transcription factor that is involved in development. Increased expression of this gene is associated with colorectal cancer. Mice that have had the murine ortholog of this gene knocked out exhibit an excessive pathologic grooming behavior. This behavior is similar to the behavior of humans suffering from the obsessive-compulsive spectrum disorder trichotillomania. [provided by RefSeq, Jul 2008]

Forensic Context

A study in rats demonstrated that the HOXB8 gene, a homeobox protein, was significantly upregulated in fetal cardiac fibroblasts compared to neonatal cells, as identified through RNA sequencing and gene set enrichment analysis [Perreault et al. DOI:10.1152/physiolgenomics.00074.2021].