| ID | Sequence | Length | GC content |
|---|---|---|---|
| CUUCUCAAUAUCAGCACUGGAUUGUAGAACUUGUUGCUGAUUUUGGCCU… | 1781 nt | 0.4127 | |
| AUCUAGAGGCUGGGAAGGGCUCCUGAACCAGUUGUUUCCGUCUUGUCGG… | 1785 nt | 0.4190 |
Amylases are secreted proteins that hydrolyze 1,4-alpha-glucoside bonds in oligosaccharides and polysaccharides, and thus catalyze the first step in digestion of dietary starch and glycogen. The human genome has a cluster of several amylase genes that are expressed at high levels in either salivary gland or pancreas. This gene encodes an amylase isoenzyme produced by the salivary gland. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
A study in humans developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for saliva identification, where the AMY1A was mentioned as initially selected for saliva-specific expression but not adopted for further study in this paper [Tsai et al. DOI:10.017/s12024-018-0008-5]. A separate study in humans using targeted high-resolution mass spectrometry for body fluid identification detected the AMY1A in 90% of saliva samples but with low coverage, suggesting resistance to endogenous proteolysis and it was not selected as a reliable biomarker for the final assay [Brown et al. DOI:10.1021/acs.jproteome.5c00711]. A study in humans demonstrated that alpha-amylase 1 is a highly abundant and specific protein biomarker for saliva identification using a mass spectrometry-based proteomic approach [Van Steendam et al. DOI:10.1007/s00414-012-0747-x]. The method, validated in blind experiments on forensic-like samples and real casework, achieved a sensitivity of 1:1,000, which was superior to a conventional enzymatic test, and allowed matrix identification without compromising subsequent DNA analysis from the same extract.