| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGAACAGUCCUCCCUGUAAGAGCCUAACCAUUGCCAGGGAAACCUGC… | 2270 nt | 0.5079 | |
| AACUUUACAGGGUCGCUAGCUAGUAGGAGGGCUUUAUGGAGCAGAAAAA… | 1708 nt | 0.4941 |
This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, which are located on different chromosomes and consist of 9 to 11 genes arranged in tandem. This gene, HOXC4, is one of several homeobox HOXC genes located in a cluster on chromosome 12. Three genes, HOXC5, HOXC4 and HOXC6, share a 5' non-coding exon. Transcripts may include the shared exon spliced to the gene-specific exons, or they may include only the gene-specific exons. Two alternatively spliced variants that encode the same protein have been described for HOXC4. Transcript variant one includes the shared exon, and transcript variant two includes only gene-specific exons. [provided by RefSeq, Jul 2008]
A study in humans demonstrated that the HOXC4 is an age-dependent DNA methylation marker, with its methylation increasing with age, and it was one of 13 markers selected for a forensic age-prediction tool using massive parallel sequencing and a random forest algorithm, achieving a mean absolute deviation of 3.16 years on an independent test set [Naue et al. DOI:10.1016/J.Fsigen.2017.07.015]. Furthermore, a scoping review of twin studies noted that increased DNA methylation at the HOXC4 locus has been associated with birth weight in singleton child and adolescent epigenome-wide association study meta-analyses [Dany Laure Wadji et al. DOI:10.1371/journal.pone.0315549].