| ID | Sequence | Length | GC content |
|---|---|---|---|
| ACUGGAAAAGAUAGUGACCUUACCAGGGCCAAAGUUUGUAGACACAGGA… | 1357 nt | 0.4996 | |
| ACUGGAAAAGAUAGUGACCUUACCAGGGCCAAAGUUUGUAGACACAGGA… | 1357 nt | 0.4982 | |
| ACUGGAAAAGAUAGUGACCUUACCAGGGCCAAAGUUUGUAGACACAGGA… | 1534 nt | 0.4967 |
This gene encodes a preproprotein, which is processed to yield both alpha and beta chains, which subsequently combine as a tetramer to produce haptoglobin . Haptoglobin functions to bind free plasma hemoglobin, which allows degradative enzymes to gain access to the hemoglobin, while at the same time preventing loss of iron through the kidneys and protecting the kidneys from damage by hemoglobin. Mutations in this gene and/or its regulatory regions cause a haptoglobin emia or hypo haptoglobin emia. This gene has also been linked to diabetic nephropathy, the incidence of coronary artery disease in type 1 diabetes, Crohn's disease, inflammatory disease behavior, primary sclerosing cholangitis, susceptibility to idiopathic Parkinson's disease, and a reduced incidence of Plasmodium falciparum malaria. The protein encoded also exhibits antimicrobial activity against bacteria. A similar duplicated gene is located next to this gene on chromosome 16. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]
A study in humans demonstrated that plasma levels of the HP were significantly upregulated in patients with Adult-onset Still’s disease (AOSD) compared to healthy controls and sepsis patients, forming part of a validated 3-miRNA diagnostic panel with an AUC of 0.8250 and a 4-miRNA panel for differentiating AOSD from sepsis with an AUC of 0.8448 [Hu et al. DOI:10.3389/fimmu.2018.03099]. A separate review noted the HP is detected in the cortex and hippocampus of Alzheimer's disease patients, indicating its broader role as a biomarker in neurological contexts [Das et al. DOI:10.1080/21655979.2021.2003667].