| ID | Sequence | Length | GC content |
|---|---|---|---|
| GCAGUCGGUGUCUCCGCGUCGCUGGGUGGGACUUGGCUCGGCGGCCAUG… | 1412 nt | 0.5942 |
The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. This protein is associated with the plasma membrane. It has similarities to proteins located in the photoreceptor cells that regulate photosignal transduction in a calcium-sensitive manner. This protein displays recoverin activity and a calcium-dependent inhibition of rhodopsin kinase. It is identical to the rat and mouse hippocalcin proteins and thought to play an important role in neurons of the central nervous system in a number of species. [provided by RefSeq, Jul 2008]
A study in mice demonstrated that the HPCA was notably upregulated in excitatory neurons in post-mortem brain samples stored for 24 to 54 hours at 25°C, where it is involved in neuronal function [Guo et al. DOI:10.1016/j.ijbiomac.2025.147708].