| ID | Sequence | Length | GC content |
|---|---|---|---|
| AGCUUCAGGCGGCUGCGACGAGCCCUCAGGCGAACCUCUCGGCUUUCCC… | 1395 nt | 0.4043 |
The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]
A study in human cadavers demonstrated that mRNA was stable in liver tissues up to 48 hours postmortem, enabling gene expression analysis where the HPRT1 was used as a stable endogenous control gene in PCR array experiments [Javan et al. DOI:10.1007/S12024-015-9704-6]. In canine research, the HPRT1 was adopted as the most suitable reference gene for normalizing mRNA levels in radiation-exposed dermal tissues [Lee et al. DOI:10.3390/ani14172505]. A study in mice demonstrated that Hprt (Hypoxanthine phosphoribosyltransferase 1) is a highly stable reference gene for qRT-PCR analysis in a multiple-trauma model combining traumatic brain injury and femoral fracture [Otto et al. DOI:10.1038/s41598-020-71895-x]. It showed consistent high expression stability across primary organs like bone/fracture callus and hypothalamus at 3 and 7 days post-injury, as well as in secondarily affected organs including liver, muscle, and spleen, validating its reliability for normalizing gene expression data in these tissues.