Basic Information

Symbol
HPRT1
RNA class
mRNA
Alias
Hypoxanthine Phosphoribosyltransferase 1 HGPRT HPRT Hypoxanthine Guanine Phosphoribosyl Transferase Hypoxanthine-Guanine Phosphoribosyltransferase EC 2.4.2.8 HGPRTase Hypoxanthine-Guanine Phosphoribosyltransferase 1 Testicular Tissue Protein Li 89 Lesch-Nyhan Syndrome
Location (GRCh38)
Forensic tag(s)
Mechanical injury analysis Postmortem interval inference

MANE select

Transcript ID
NM_000194.3
Sequence length
1395.0 nt
GC content
0.4043

Secondary Structure

Generated by RNAfold
Minimum free energy (MFE) structure:
Secondary structure that contributes a minimum of free energy.
Ensemble properties:
Thermodynamic properties of the Boltzmann ensemble.
Minimum free energy
-363.70 kcal/mol
Thermodynamic ensemble
Free energy: -393.27 kcal/mol
Frequency: 0.0000
Diversity: 386.46
MFE Structure Visualization
Structure Prediction
MFE Structure Prediction
(((...(((((((((((.((((((...(((....)))...))))....))))))..)))))))...)))((((((((..((((((.((..(((...((((...((((...((((.((((...((((.((......)).)))).(((((.(((........))).)))))..((((((((..(((((((((.((((....)))).).)))))....)))..))))))))..)))).))))...))))..)))).(((.(((....))).))).....((((((((.....)))))).)))))....)).).)))))...)))))).......((((((((((((.((....)).)))))))))))).....((((((((.((((.(((...)))..))))((((.((((((((((.((((........)))).)))))...)))))))))(((((((.(((((((.(((((((((...((((((((((((........(((((((((((.(((((((((((.((((((((((((.((((..(((((.........................)))))..)))).)).))))))((.(((((((.((((.........((((((((((..(((((((((((((......(((.((.(((((((.((((.......))))))))))).)).)))......)))).))))))))).(((.....))))))))))))).((((....(((((....))))))))).(((((....(((((...)))))....)))))))))...))))..))).)))))).))))))))...)))..)))))((.(((.....))).))........(((((.((((((((((.(((((((((..(((((...))))))))((((((((((((......(((......))).........(((((.((((.(((...))))))).)))))...((((((((((...(((((...........((((((((....)).))))))..)))))...))))))))))....(((((((........(((....(((((..........)))))....)))........)))))))((.(((((((((....))))))))).)).......))))))))))))....)))))).))...)))))))).)))))...)))))))))))).........(((.((.(((...............))).)).)))...........)))))).))))..))))).))))))).)))))))...(((.((((((......................)).)))).)))....)))))))).............)).......((((((......)))))).
Thermodynamic Ensemble Prediction
,((...(((((((((((.{(((((...(((....)))...)))),...}})))},.)))))))...))|({((((((..((((({.{(,{{((,{,({{{,,,{(((...((((.((((...{(((.((,.....)).)))}.((({{.(((........))).)))))..((((((((,{({((((((.{((((....)))},).))))),...)))..))))))))..)))).))))...)))}.,}}}}.{{{.(((....))).}},...,|{|((((((....,)))))}.}})))},}}}}.).}))))..,)))))),,.....((((((((((((.((....)).)))))))))))).....{(((((((.{(((.(({...}})..)))}((({,((((((((((.((((........)))).)))))...)))))))))(((((({.(((((((.(((((((((...((((({,({{..,,,.,...,{{{{((((...,})))}||||{{..,({{{.,,..((((((((,{((((({.....,{((((({(((((....,,.|{{,(({(({((({{({{{{{{{{{{,.,,,,..,||,..,{({{{{{{{|,|(((((((((((((......(((.((.(((((((.((((.......)))}))))))).)).)))......)))).))))))))).{,,,....,},}))))))))).,{{|||,,|||||||,||||,}},.|,{{{||.||,|{{{{...}}})),.,,)))},,,.}.,.,||}.{{{{{,,.,|{{|{|,.,,.|}}}|}..}})))))}})).,,}||||,|||}}}||,.(((((.((((((((((.((((((,{{..(((((...)))))))|((((((((((({....,,((({{,....,,,,.....,.(((((.((((.(((...))))))).))))}...((((((((((...{{{{{...||{{{.,.((((((((....)).)))))),,))))}...)))))))))}....{((((((.....,{{(,{.,,.(((((..........))))).,.})))........))))))}{{.(((((((((....))))))))).}}.,}}}}})))))))))))),...)))))).))...)))))))).))))).|||....}}))}}|}.....,|,....}}.))))))))))))))),}}))))...)))}.,,)))).}})))))).))))..))))).))))))).}))))))...(((,({{{{,.......,,..,,.........,},,))),))}....)))))))}.............)).......{{{{{,......,}}}}}.

Transcripts

ID Sequence Length GC content
AGCUUCAGGCGGCUGCGACGAGCCCUCAGGCGAACCUCUCGGCUUUCCC… 1395 nt 0.4043
Summary

The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]

Forensic Context

A study in human cadavers demonstrated that mRNA was stable in liver tissues up to 48 hours postmortem, enabling gene expression analysis where the HPRT1 was used as a stable endogenous control gene in PCR array experiments [Javan et al. DOI:10.1007/S12024-015-9704-6]. In canine research, the HPRT1 was adopted as the most suitable reference gene for normalizing mRNA levels in radiation-exposed dermal tissues [Lee et al. DOI:10.3390/ani14172505]. A study in mice demonstrated that Hprt (Hypoxanthine phosphoribosyltransferase 1) is a highly stable reference gene for qRT-PCR analysis in a multiple-trauma model combining traumatic brain injury and femoral fracture [Otto et al. DOI:10.1038/s41598-020-71895-x]. It showed consistent high expression stability across primary organs like bone/fracture callus and hypothalamus at 3 and 7 days post-injury, as well as in secondarily affected organs including liver, muscle, and spleen, validating its reliability for normalizing gene expression data in these tissues.